Endophtalmitis Following Fusarium Solani Infection and Rescue Therapy with Voriconazole

Abstract

We describe a case of severe endophthalmitis following traumatic contacts with vegetal debris caused by Fusarium solani with descemet membrane detachment in a patient with hepatitis C virus related cirrhosis. Patient came to the Emergency rooms complaining of redness and ocular pain in his right eye. The first clinical diagnosis was traumatic corneal ulcer. Culture was indicated because the corneal infiltrate involved the central cornea, involved the deep stroma and covered a large area (more than 2mm): unfortunately the results were negative. Antibiotic and antifungal eye drops were prescribed with poor response. Two weeks later the ulcer grew fungus identified as Fusarium solani. Patient underwent therapy with systemic voriconazole (6mg/kg bid first day, followed by 4mg/kg bid from the second day) and intravitreal administration of voriconazole (0,05mg). Keratitis persisted and the thickness of cornea reduced to require corneal transplantation.

We need to keep in mind Fusarium in cases of injury from vegetable matter, especially in a rural area. The prompt microbiological diagnosis and the management with voriconazole, both systemically and intravitreally, made possible the resolution of endophthalmitis and the anatomical preservation of the eye.

Keywords: Fusarium; Endophthalmitis; Voriconazole; Intravitreal therapy

Introduction

Fusarium species are widely distributed in soil, water and organic substrates [1,2]. In healthy subjects Fusarium keratitis may cause endophthalmitis following injuries with vegetal debris or intraocular surgery. Patients with ocular surface disease or use of contact lens are at higher risk of corneal ulcers. Fusarium cause severe damage to the eye and up to 30% of infections caused by Fusarium requires enucleation [3,4]. The clinical management is based on the association of topical and systemic antifungal drugs but the intravitreal way of administration plays a pivotal role in the resolution of endophthalmitis. We describe a case of endophthalmitis caused by Fusarium solani complicated by descemet membrane detachment.

Case Presentation

Fifty three year-old male with two weeks history of persisting and recurrent keratitis in his right eye following trauma with vegetal debris came to our attention. Patient underwent uneventful cataract surgery one year before with final visual acuity (VA) 20/20. Eighteen months later, patient came to the Emergency Department complaining of pain, photophobia, and red eye in his right eye. Clinically at slit lamp examination +2 conjuctival injections, central corneal ulcer with thinning and diffuse corneal edema were observed. Neither satellite infiltrates nor hypopyon were observed. A clinical diagnosis of corneal ulcer was made and topical antibiotics (fluoroquinolones) were prescribed because the low risk of perforation. Three days later, colleagues decided to culture the ulcer because of a worsening scenario and, waiting for the response of the microbiological results, patient underwent topical multimolecular therapy including antifungal agents (Chloramphenicol, vancomycin, and fluconazole 2mg/50ml eye drops) every two hours. Culture was indicated because the corneal infiltrate involved the central cornea, involved the deep stroma and covered a large area (more than 2mm): unfortunately the results were negative. With the onset of hypopyon, forty eight hours later, patient was admitted to the surgical theatre to perform aqueous tap. Vancomycin was also administered intravitreally [5,6]. Patient underwent intensive topical therapy with eye drops (Gentamicin coll 10ml 0.3%, vancomycin 1000, Trifluridine gel, Ceftazidime 2g, Chloramphenicol gel 5g, Netilmicin 0.3%) every two hours and fluconazole eye drops (2mg/50ml) every hour and parenteral vancomycin. The response to the first aqueous tap resulted negative. Meanwhile the corneal ulcer looked serious despite aggressive therapy. Patient underwent amniotic membrane transplantation to prevent perforation. October the 14th aqueous tap was repeated and assistance from local microbiological Department was asked. October the 15^th we cultured the ulcer and we identified a fungus (Figure 1). Genomic DNA was extracted using the PrepManTM Ultra Sample Preparation reagent (Applied BioSystems). A standard Polymerase Chain Reaction (PCR) was used to amplify the TEF gene region using the primers ef1 (ATGGGTAAGGAGGACAAGAC) and ef2 (GGAAGTTACCAGTGATCATGTT). The PCR was performed in a 2700 Thermal Cycler (Applied BioSystems) set to the following: denaturation at 94°C for 5min; 30 cycles of 94°C for 30s, 62°C for 30s, 72°C for 1min; and a final extension at 72°C for 7min. The TEF PCR products (≈700 bp) were visualized on 2% agarose gel stained with ethidium bromide and used as a template for DNA sequencing using Big Dye terminators (Applied BioSystems) in a 310 ABI PRISM sequencer (Applied BioSystems). Nucleotide sequences were analysed using Finch TV software Version 1.4.0 and blasted in the FUSARIUM-ID server at https://fusarium.cbio.psu.edu database [7]. The strain was identified as Fusarium solani.

    

    

    Figure 1: Microscopic Features of macroconidia of Fusarium solani
Lactophenol cotton blue stain-400x.