Expression Analysis of Mitogen-Activated Protein Kinases (MAPKs) Gene Family in Grapevine Berries

Abstract

Plants, as sessile living organisms, are dependent on signalling mechanisms. Mitogen-activated protein kinases (MAPKs) are a highly conserved gene family that take a role in switching an extracellular signal into an intercellular signal. Ripening-related processes in non-climacteric fruits are not as well understood as in climacteric fruits. In this regard, studying MAPKs in grape berries during developmental stages may lead to a better understanding of physiological interactions during commercially relevant stages, such as pigmentation, ripening, and phenolics accumulation in the berries. Each MAPK cascade involves three or four MAPK proteins that facilitate signal transduction by phosphorylation of downstream targets. We examined the relative expression of VvMAP2Ks and VvMAP4Ks in berries at two-weekly intervals, from flowering to over-ripening. Expression analysis of 5 MAP2Ks and 7 MAP4Ks suggested that both gene families may play an active role in development of berries. Expression of VvMAP2K1 showed a correlation with abscisic acid (ABA) and ethylene accumulation. Moreover, the expression pattern of VvMAP2K2 and VvMAP2K3 shows a correlation with auxin, and ABA accumulation respectively. Furthermore, VvMAP2K4 may have a role in berry size increment and halting stomatal development. In addition, VvMAP2K5 may play a role in floral organ development. VvMAP4Ks expression pattern moves them forward to be excellent markers for monitoring the effect of for instance climate changerelated stress on berry development.

Keywords: Ripening; Veraison; Flowering; Fruit-set; Viticulture; Transcriptomics

Abbreviations

MAPK: MPK: Mitogen Activated Protein Kinase; MAP2K: MAPKK: MKK: Mitogen Activated Protein Kinase Kinase; MAP3K: MAPKKK: MKKK: Mitogen Activated Protein Kinase Kinase Kinase; MAP4K: MAPKKKK: MKKKK: Mitogen Activated Protein Kinase Kinase Kinase Kinase; SDS: Sodium Dodecyl Sulfate; PEG: Polyethylene Glycol; PVPP: Polyvinylpolypyrrolidone; ABA: Abscisic Acid; JA: Jasmonic Acid; BRs: Brassinosteroids; SIMK: Stress- Induced Mitogen-Activated Protein Kinase; SAMK: Stress-Activated Mitogen-Activated Protein Kinase; WIPK: Wound-Induced Mitogen-Activated Protein Kinase; HR: Hypersensitive Response; CTR: Constitutive Triple Response; NAA: Naphthaleneacetic Acid; DEPC: Diethyl Pyrocarbonate

Introduction

Grapevine is the most widely grown fruit crop in the world, covering approximately 7.454 million hectares in 2016 and producing more than 270 million hectoliters of wine [1]. The development of the grape berry, from fruit setting to overripening, is a complex process that requires a large number of events. Although the changes that occur as the berry begins to ripen have received considerable attention, their overall control and coordination remain poorly understood. Signalling regarding coordination is a crucial issue in berry development, as the changes that occur at both the physical and biochemical levels are considerable and rapid, occurring over only a few weeks.

According to Coombe [2], grape berry development is a dynamic process divided into three major phases. During Phase I, starting at fruit set, the diameter of the grape berry may double in size due to cell division and subsequent cell expansion, and organic acids, tannins, and hydroxycinnamates accumulate to peak levels. The second major phase (Phase II) is defined as a lag phase in which cell expansion ceases and berries remain firm. Sugars begin to accumulate and berries lose chlorophyll. The beginning of the third major phase (Phase III) is marked by ‘veraison’ as the onset of ripening in which berries undergo a second period of growth due to additional mesocarp cell expansion, accumulation of sugars, pigments, volatile compounds and a decline in organic acid accumulation.

The complexity of the molecular control during berry ripening has been exemplified by recent development in transcriptomics. Moreover, differential screening, cDNA, and oligonucleotide microarray analysis have shown that the expression of thousands of genes, including large numbers of transcription factors, do actually change during grape berry ripening [3-9].

Mitogen-activated protein kinases (MAPKs) represent a large group of proteins taking role in signal transduction within a cell. They consist of three or four MAPK proteins: MAPK, MAPK kinase (MAPKK = MAP2K), MAPK kinase kinase (MAPKKK = MAP3K), and MAPK kinase kinase kinase (MAPKKKK = MAP4K). The MAPK pathway plays an important role in the conversion of an extracellular signal into an intercellular one through protein phosphorylation. MAPK proteins sequentially activate each other by phosphorylation. In other words, MAPKs form signalling modules where MAPK kinase kinases (MAPKKKs) activate MAPK kinases (MAPKKs) which in turn activate MAPKs. Activated MAPK can trigger a pathway or activate a transcription factor [10,11]. In addition to this, MAPK proteins have the potential to crosstalk with other pathways or can act as a negative regulator [12]. For instance, CTR1, which is a MAPKKK, is known as a negative regulator of ethylene signalling [13]. They are highly conserved in eukaryotes including yeast, animals, and plants where they are involved in cytokinesis, differentiation, proliferation, hormonal responses; abiotic and biotic stress signalling and developmental programs [10,14-16].

Expression analysis of MAPK genes during berry developmental stages can create an understanding of both primary and secondary metabolisms during berry ripening. To our knowledge, this is the first report about the expression of VvMAP2Ks and VvMAP4Ks during grape berry development. These markers may lead us to a better understanding of signalling processes specifically, and grape berry development physiology in general.

Materials and Methods

Plant tissue

Seedless grapes, Vitis vinifera ‘Sultana’ berries were used for analysis. Berries were collected every two weeks from fruit set (26.05) until full ripening (17.09) from an 8-years-old vineyard located at the Ege University Agricultural Experiment Station, Izmir, Ege, Turkey. Berries were sampled from different blocks, immediately frozen and ground in liquid nitrogen to be stored at -80°C.

RNA extraction

Total RNA from grape berries of the variety Sultana was extracted according to Davies and Robinson [17], with an additional step of selective precipitation with 2 M LiCl. The extraction buffer contained 0.3 M Tris, 5 M Sodium perchlorate monohydrate (ClH₂NaO₅), 1% SDS, 2% PEG, 8.5% PVPP, and just prior to use, 1% Β-mercaptoethanol. Two grams of ground powder was added to a pre-warmed (30-35°C) extraction buffer at 5ml/g of tissue and shaken at 37°C for 90 minutes at 180 × rpm. Vacuum filtration was done before adding 96% alcohol and was kept overnight at -20°C.

On the second day, samples were centrifuged at 4°C for 30 minutes at 5000 × rpm. 2ml of 70% alcohol was added prior to centrifugation at 4°C for 5 minutes at 5000 × rpm. The precipitate was dissolved in DEPC water, and mixtures were extracted twice with equal volumes of phenol:chloroform:isoamyl alcohol (25:24:1, v/v) then centrifuged at 10,000 × rpm for 7 minutes at 4°C. Chloroform:isoamyl alcohol (24:1, v/v) was added to the supernatant before a centrifuge at 10,000 × rpm for 7 minutes at 4°C. Ten % (V/V) of 3 M NaOAc (pH 5.2) was added to the supernatant, mixed, and then stored at -80°C for 90 minutes. Total RNA pellets were collected by centrifugation at 10,000 × rpm for 20 minutes at 4°C. Each pellet was dissolved in 200μl of DEPC water prior to adding 100μl of 10 M LiCl as the last step of the second day and this was stored at 4°C for 16-20 hours. On the third and the last day, pellets were collected by centrifugation at 10,000 × rpm for 40 minutes at 4°C, 500μl of 70% alcohol was added to the pellet prior to centrifugation at 10,000 × rpm for 5 minutes at 4°C. The pellet was dissolved in 30μl of DEPC water and was stored at -20°C.

Quantitative real-time PCR (qRT-PCR)

The expression of MAPK genes in grape berries were confirmed by qRT-PCR analysis. Total RNA was extracted from samples as above and treated with DNase I (Fermentas, USA). First-strand cDNA was performed by using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Switzerland) according to the manufacturer’s protocol.

Çakir and Kiliçkaya [18] revealed the existence of 14 MAPKs, 5 MAP2Ks, 62 MAP3Ks, and 7 MAP4Ks in Vitis vinifera, which were used as primer data information. VvActin was used as a housekeeping gene in regard to normalization and elimination of pipetting errors [19].

Primers used are listed in Table 1. LightCycler^® FastStart DNA Master SYBR Green I Kit (Roche, Switzerland) was utilized for preparation of qRT-PCR reactions and reactions were run by using Roche LightCycler 480. Three replicates were conducted to analyze the expression of each gene under each condition. The 2^-ΔΔCT method was used for calculation of relative expression levels [20]. Transcript abundance was normalized to that of Vvactin.

Table 1: Vitis vinifera MAP2K and MAP4K subfamilies and related primers.

  

    
Gene Locus ID 
    
Gene Name 
    
Forward Primers (5’-3’) 
    
Reverse Primers (5’-3’) 
  
  

    
GSVIVT01008476001 
    
VvMAP2K1
    
AACTCCTACGTGGGCACCTG 
    
AATTGGAGCCGTGGGAGTCG 
  
  

    
GSVIVT01015155001 
    
VvMAP2K2
    
ACCAGTTGAGCTTGGCTGACA 
    
GCTTGAGAGCAGCCTCCTGA 
  
  

    
GSVIVT01015283001 
    
VvMAP2K3
    
TGCTCAAGAAACCCCTATCAC 
    
TCAGAGATAAGCCGCAAACC 
  
  

    
GSVIVT01016115001 
    
VvMAP2K4
    
AGCCGGATCTTGGCTCAGAC 
    
CACACCGAGGCTCCAGATGT 
  
  

    
GSVIVT01032414001 
    
VvMAP2K5
    
TGCTCATTTATTGATGCTTGCCTTCA 
    
TGCTTCGGACAAATGCCGTT 
  
  

    
GSVIVT01012233001 
    
VvMAP4K1
    
GCGGTGCTAGTGCATCGTC 
    
GCCTGAAATCGGGCTTCGTC 
  
  

    
GSVIVT01013739001 
    
VvMAP4K2
    
AGGCTGGGAATATCTTGGTTG 
    
TGCATAACTTCAGGAGCCATC 
  
  

    
GSVIVT01014297001 
    
VvMAP4K3
    
GCAATTGGTCATGCAGTGGCA 
    
AGTTGCCAGCTCCTGAAGGT 
  
  

    
GSVIVT01016074001 
    
VvMAP4K4
    
TCATCATCCTCATGCCCTTCCC 
    
GAGCAGCAGACACGGAGGAA 
  
  

    
GSVIVT01019643001 
    
VvMAP4K5
    
GCTCCTCGAAGAGGTCGGTT 
    
CCAAACACTTAACGGCCACCA 
  
  

    
GSVIVT01027718001 
    
VvMAP4K6
    
TTCTCAGAGCCCACTGTTCGT 
    
TGGCAATGCAGGGTTCTGGT 
  
  

    
GSVIVT01032461001 
    
VvMAP4K7
    
CCCGAGCGGAACTATAGTGGT 
    
TGGGACTGAGCTCTGCTGAAG 
  
  

    
XM_010652725 
    
VvActin
    
GGAATGGTTAAGGCTGGATTTG 
    
GGTTGAGAGGAGCTTCAGTTAG 
  
  

    
Primer information for VvMAP2Ks and VvMAP4Ks.    The first column shows the putative gene IDs in the Vitis vinifera genome sequencing project Genoscope (Genoscope    website: http://www.genoscope.cns.fr/externe/ GenomeBrowser/vitis). Actin    gene’s ID is according to NCBI (National Centre for Biotechnology    Information). The second column contains gene’s preferred name according to    Cakir and Kilickaya [18]. 
  

Table 1: Vitis vinifera MAP2K and MAP4K subfamilies and related primers.

Close

Statistical data analyses

A T-test was performed. The P-value for all primers was less than 0.01, indicating that the results were statistically significant.

Results

In order to examine expression levels of various MAPKs in Vitis vinifera at different stages of berry development, we performed qRTPCR. Details about VvMAP2Ks expression are presented in Figure 1. There was a significant increase in transcript levels of VvMAP2K1 at the flowering stage, one month before veraison, during veraison and a month after veraison. However, the expression of VvMAP2K1 was strongly suppressed during the ripening period and suddenly increased in the over-ripening period. Furthermore, an increase was observed in the expression of VvMAP2K2 during flowering, as well as in week six and explicit at veraison. When the expression profile of the VvMAP2K3 gene was examined, it was clear that its expression also increases during the veraison period. The expression level was quite low before and after veraison. Relative expression of VvMAP2K4 showed increments at flowering and veraison and a month after veraison. The VvMAP2K5 gene showed high expression in the period of flowering, veraison, and just before ripening. Expression of this gene was suppressed one month after the fruit set and during ripening.

Figure 1: Relative expression of VvMAP2K genes from flowering (Week 0) to over-ripening (week 18). Week 2 represents the fruit set that marks the beginning of Phase I of berry development. The period from week 6 until the end of week 8 is considered as Lag phase (Phase II). Phase III (veraison) starts at week 10. Week 16 represents the ripening point.

    

    

    Figure 1: Relative expression of VvMAP2K genes from flowering (Week 0) to over-ripening (week 18). Week 2 represents the fruit set that marks the beginning of
Phase I of berry development. The period from week 6 until the end of week 8 is considered as Lag phase (Phase II). Phase III (veraison) starts at week 10. Week
16 represents the ripening point.
    

Close

Details about the expression VvMAP4Ks were shown in Figure 2. Expression of the VvMAP4K1 gene gradually increased from veraison at two weeks before ripening and was suddenly suppressed during the ripening period; expression of VvMAP4K2 increased one month after the fruit set. In other periods, the expression of the VvMAP4K2 gene was low. It was observed that the expression of the VvMAP4K3 gene increased considerably during the veraison period, in contrast with the slight expression of the gene after the flowering period and one month after veraison. In other periods, the expression of the gene remained at deficient levels and was even almost non-existent in the ripening period. The VvMAP4K4 suddenly showed a high level of expression one month after fruit set but was then suppressed two weeks later. However, it had a low expression level from veraison prior to the ripening period. It was also observed that the expression of the VvMAP4K5 increased during the period from veraison until the period before ripening, and was again suddenly cut out during the ripening period. Expression of the VvMAP4K6 increased from flowering to fruit set and then dropped down, abruptly increasing one month after the fruit set, and becoming suppressed before veraison. It increased gradually from the period of veraison to ripening and was totally dropped in the ripening period. The expression of the VvMAP4K7 again increased suddenly in the veraison period and was abruptly suppressed afterward, showing a similar expression until the period of overripening.

Figure 2: Relative expression of VvMAP4K genes from flowering (week 0) to over ripening (week 18). Week 2 represents the fruit set that marks the beginning of Phase I of berry development. The period from week 6 until the end of week 8 is considered as Lag phase (Phase II). Phase III (veraison) starts at week 10. Week 16 represents the ripening point.

    

    

    Figure 2: Relative expression of VvMAP4K genes from flowering (week 0) to over ripening (week 18). Week 2 represents the fruit set that marks the beginning of
Phase I of berry development. The period from week 6 until the end of week 8 is considered as Lag phase (Phase II). Phase III (veraison) starts at week 10. Week
16 represents the ripening point.
    

Close

Discussion

When the expression profiles of the VvMAP2K, and VvMAP4K gene families were examined, a decrease in the expression levels of all genes was observed during week 16. Besides, it is known that a vast number of physiological processes are regulated in week 16 including but not limited to sugar accumulation, flavour compound and anthocyanin production, suggesting the role of VvMAP2Ks and VvMAP4Ks in these ranges of processes [21]. Since MAPK genes are mainly known to play a role in abiotic and biotic stress, most MAPKrelated breeding programs are aimed at creating resistant vines. Our data suggest that any change in MAPK genes will affect not only resistance but also berry ripening.

Several studies showed a relation between the expression of MAP2K1 and ABA and its effect on defence responses, especially abiotic stresses, including salt stress [22-26]. Although the sampled vines were not in apparent stress, our data show a positive correlation between the expression of VvMAP2K1 and the presence of ABA in berries [27], which remains relatively high from weeks 10 to 14 after flowering.

Stanko et al. [28] showed a correlation between the AtMKK2- AtMPK10 pathway and auxin accumulation. Plus, Ziliotto et al. [29] showed that Naphthalene Acetic Acid (NAA) inhibits ripening in berries. Although VvMAP2K2’s expression indicates a correlation with IAA in berries from flowering to veraison, it shows a peak in expression during veraison when IAA level is low [30]. Since this cannot be related to auxin accumulation, our data suggests that VvMAP2K2 is not only involved in auxin related pathways and it may play a role in other pathways too.

De Zelicourt et al. [31] showed that the MAP3K17/18-MKK3- MPK1/2/7/14 cascade is under the control of ABA core signalling pathway. Similarity in ABA accumulation pattern [27] and VvMAP2K3 expression during berry development supports the thesis of ABA’s effect on above-mentioned MAPK pathway.

MAP2KK4 genes are known to play a role in controlling cell division, organ shape, and size [32,33]. Accordingly, it is assumed that the VvMAP2K4 gene may similarly play a role in the berry size increment along a sigmoidal growth curve that drops abruptly, due to its increased expression level during berry growth. It has been reported in previous studies that the MAP2K4 gene is responsible for suppressing stomatal development [34,35]. In addition, it is known that the stomata of the fruit become dysfunctional in the veraison period [36]. An increase in the level of VvMAP2K4 expression in this period suggests that it may be associated with halting stomatal development.

Further, MAP2K5 is part of the MKK4/MKK5-MPK6 cascade control in maternal embryogenesis and floral organ development [37, 38]. Relatively high expression of VvMAP2K5 during the flowering period supports this idea. Khan et al. [35], showed a correlation between brassinosteroids and YODA-MKK4/5-MPK3/6 cascade responsible for cellular patterning, and cell’s fate in A. thaliana. Since the BRs accumulation in grape berries is high after veraison until ripening ([39], our data suggest a relation between BRs and VvMAP2K4/5. during grape berry development. The first one states its level starts high at flowering time and then drops quickly to stay at a low level during subsequent berry development ([40, 41]). The second model indicates that there is a peak not only during flowering, but also at week 8 [42]. In addition to this, Novikova et al. [43], and Ouaked et al. [44] showed a correlation between the ethylene and MAPK cascade. Our data only supports the first model: VvMAP2K1 is strongly present during flowering period and likewise stays relatively low until the end of ripening. However, our data do not constitute evidence for the second model. In other words, there is no candidates VvMAP2K or VvMAP4K that show a peak in expression during week 8.

The only GA, which is detected in grape berries, is GA3, which concentration is relatively high during flowering, decreases dramatically and remains low and unchanged through the end of berry development [39]. To our knowledge, there is no research showing a correlation between GAs and MAPKs. Our data also do not show any direct correlation between GA3’s accumulation and VvMAPKs expression.

It is clear that MAP4Ks play a role in cascade initiation by sensing start signals in the MAPK pathway. A sudden increase and decrease of their expression in specific periods may relate to this. In addition to this, the characteristic, relatively high expression in only a specific period for MAP4Ks suggests their ability to be utilized as markers. For instance, VvMAP4K2 could be used as a marker to show the initiation of the lag phase. In another example, VvMAP4K3 could be used as a marker to show the veraison. The lack of published findings on MAP4Ks in plants makes it impossible to come to any more conclusions. Additional supportive data are required.

Conclusion

Each expression pattern of the 12 genes belonging to the Vitis vinifera VvMAP2K and VvMAP4K subfamilies was examined by real-time PCR in different developmental periods of grape berries. Although all-over, their expression decreased in the ripening period, their expression during other developmental periods widely differed. This confirms their role in this important phase of the grape life cycle. In addition to this, it is noteworthy to mention that MAP4Ks subfamily in plants is not so well studied as it is in human and animal biology. Our results suggested that the MAP4K gene subfamily should receive more attention. Their high expression (or lack of expression) at specific developmental phases moves them forward to be excellent markers for monitoring the effect of for instance climate change related stress on berry development. It is noteworthy that MAPK proteins can also behave as negative regulators. In other words, not only the expression of MAPK genes but their suppression can trigger specific pathways. In addition to this, they can crosstalk with other pathways. Therefore, the decisive conclusion of their role requires more supportive data.

Funding and Acknowledgement Statement

This work was funded by Ege University Scientific Research Project Coordination, Project number 16-ZRF-001, Ege University, Turkey.

References

1. OIV (The International Organization of Vine and Wine), viewed. 2020.
2. Coombe BG. Research on Development and Ripening of the Grape Berry. American Journal of Enology and Viticulture. 1992; 43: 101.
3. Davies C and Robinson SP. Differential screening indicates a dramatic change in mRNA profiles during grape berry ripening. Cloning and characterization of cDNAs encoding putative cell wall and stress response proteins. Plant physiology. 2000; 122: 803-812.
4. Terrier N, Glissant D, Grimplet J, Barrieu F, Abbal P, Couture C, et al. Isogene specific oligo arrays reveal multifaceted changes in gene expression during grape berry (Vitis vinifera L.) development. Planta. 2005; 222: 832-847.
5. Deluc LG, Grimplet J, Wheatley MD, Tillett RL, Quilici DR, Osborne C, et al. Transcriptomic and metabolite analyses of Cabernet Sauvignon grape berry development. BMC Genomics. 2007; 8: 429.
6. Lund ST, Peng FY, Nayar T, Reid KE, Schlosser J. Gene expression analyses in individual grape (Vitis vinifera L.) berries during ripening initiation reveal that pigmentation intensity is a valid indicator of developmental staging within the cluster. Plant molecular biology. 2008; 68: 301-315.
7. Giribaldi M, Perugini L, Sauvage FX, Schubert A. Analysis of protein changes during grape berry ripening by 2-DE and MALDI-TOF. Proteomics. 2007; 7: 3154-3170.
8. Serrano A, Espinoza C, Armijo G, Blancheteau CI, Poblete E, Meyer- Regueiro C, et al. Omics Approaches for Understanding Grapevine Berry Development: Regulatory Networks Associated with Endogenous Processes and Environmental Responses. Frontiers in plant science. 2017; 8: 1486.
9. Wang G, Liang YH, Zhang JY, Cheng ZM. Cloning, molecular and functional characterization by overexpression in Arabidopsis of MAPKK genes from grapevine (Vitis vinifera). BMS Plant Biology. 2020; 20: 194.
10. Bigeard J and Hirt H. Nuclear Signaling of Plant MAPKs. Frontiers in Plant Science. 2018; 9: 18.
11. Colcombet J and Hirt H. Arabidopsis MAPKs: a complex signalling network involved in multiple biological processes. Biochemical Journal. 2008; 413: 217-226.
12. Fey D, Croucher DR, Kolch W and Kholodenko BN. Crosstalk and Signaling Switches in Mitogen-Activated Protein Kinase Cascades. Frontiers in Physiology. 2012; 3: 355.
13. Zhang T, Liu Y, Yang T, Zhang L, Xu S, Xue L, et al. Diverse signals converge at MAPK cascades in plant. Plant Physiology and Biochemistry. 2006; 44: 274-283.
14. Jagodzik P, Zielinska MT, Ciesla A, Marczak M, Ludwikow A. Mitogen- Activated Protein Kinase Cascades in Plant Hormone Signaling. Frontiers in plant science. 2018; 9: 1387-1387.
15. Meng X, Zhang S. MAPK cascades in plant disease resistance signaling. Annual review of phytopathology. 2013; 51: 245-266.
16. He X, Wang C, Wang H, Li L, Wang C. The Function of MAPK Cascades in Response to Various Stresses in Horticultural Plants. Frontiers in Plant Science. 2020; 11: 952.
17. Davies C, Robinson SP. Sugar accumulation in grape berries: cloning of two putative vacuolar invertase cDNAs and their expression in grapevine tissues. Plant Physiol. 1996; 111: 275-283.
18. Çakir B, Kiliçkaya O. Mitogen-activated protein kinase cascades in Vitis vinifera. Frontiers in plant science. 2015; 6: 556.
19. Reid KE, Olsson N, Schlosse J, Peng F, Lund ST. An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real-time RT-PCR during berry development. BMC plant biology. 2006; 6: 27.
20. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif.). 2001; 25: 402-408.
21. Loureiro V, Ferreira MM, Monteiro S, Ferreira RB. The Microbial Community of Grape Berry. Geros H, Chaves MM, Delrot S. The Biochemistry of the Grape Berry (Bentham Science Publishers). 2012; 241-268.
22. Xing Y, Jia W, Zhang J. AtMKK1 mediates ABA-induced CAT1 expression and H₂O₂ production via AtMPK6-coupled signaling in Arabidopsis. The Plant Journal. 2008; 54: 440-451.
23. Meszaros T, Helfer A, Hatzimasoura E, Magyar Z, Serazetdinova L, Rios G, et al. The Arabidopsis MAP kinase kinase MKK1 participates in defence responses to the bacterial elicitor flagellin. The Plant journal for cell and molecular biology. 2006; 48: 485-498.
24. Hadiarto T, Nanmori T, Matsuoka D, Iwasaki T, Sato KI, Fukami Y, et al. Activation of Arabidopsis MAPK kinase kinase (AtMEKK1) and induction of AtMEKK1-AtMEK1 pathway by wounding. Planta. 2006; 223: 708-713.
25. Qiu J-L, Zhou L, Yun B-W, Nielsen H-B, Fiil BK, Petersen K, et al. Arabidopsis mitogen-activated protein kinase kinases MKK1 and MKK2 have overlapping functions in defense signaling mediated by MEKK1, MPK4, and MKS1. Plant physiology. 2008; 148: 212-222.
26. Xing Y, Jia W, Zhang J. AtMEK1 mediates stress-induced gene expression of CAT1 catalase by triggering H₂O₂ production in Arabidopsis. Journal of experimental botany. 2007; 58: 2969-2981.
27. Wheeler S, Loveys B, Ford C and Davies C. The relationship between the expression of abscisic acid biosynthesis genes, accumulation of abscisic acid and the promotion of Vitis vinifera L. berry ripening by abscisic acid. Australian Journal of Grape and Wine Research. 2009; 15: 195-204.
28. Stanko V, Giuliani C, Retzer K, Djamei A, Wahl V, Wurzinger B, et al. Timing is everything: highly specific and transient expression of a MAP kinase determines auxin-induced leaf venation patterns in Arabidopsis. Molecular plant. 2014; 7: 1637-1652.
29. Ziliotto F, Corso M, Rizzini FM, Rasori A, Botton A, Bonghi C. Grape berry ripening delay induced by a pre-véraison NAA treatment is paralleled by a shift in the expression pattern of auxin- and ethylene-related genes. BMC Plant Biology. 2012; 12: 185.
30. Böttcher C, Keyzers RA, Boss PK, Davies C. Sequestration of auxin by the indole-3-acetic acid-amido synthetase GH3-1 in grape berry (Vitis vinifera L.) and the proposed role of auxin conjugation during ripening. Journal of experimental botany. 2010; 61: 3615-3625.
31. De zelicourt A, Colcombet J, Hirt H. The Role of MAPK Modules and ABA during Abiotic Stress Signaling. Trends in plant science. 2016; 21: 677-685.
32. Cho SK, Larue CT, Chevalier D, Wang H, Jinn TL, Zhang S, et al. Regulation of floral organ abscission in Arabidopsis thaliana. Proceedings of the National Academy of Sciences. 2008; 105: 15629.
33. Meng X, Wang H, He Y, Liu Y, Walker JC, Torii KU, et al. A MAPK cascade downstream of ERECTA receptor-like protein kinase regulates Arabidopsis inflorescence architecture by promoting localized cell proliferation. The Plant cell. 2012; 24: 4948-4960.
34. Wang H, Ngwenyama N, Liu Y, Walker JC, Zhang S. Stomatal development and patterning are regulated by environmentally responsive mitogenactivated protein kinases in Arabidopsis. The Plant cell. 2007; 19: 63-73.
35. Khan M, Rozhon W, Bigeard J, Pflieger D, Husar S, Pitzschke A, et al. Brassinosteroid-regulated GSK3/Shaggy-like kinases phosphorylate mitogen-activated protein (MAP) kinase kinases, which control stomata development in Arabidopsis thaliana. The Journal of biological chemistry. 2013; 288: 7519-7527.
36. Blanke MM, Leyhe A. Stomatal Activity of the Grape Berry cv. Riesling, Müller- Thurgau and Ehrenfelser. Journal of Plant Physiology.1987; 127: 451-460.
37. Liu H, Wang Y, Xu J, Su T, Liu G, Ren D. Ethylene signaling is required for the acceleration of cell death induced by the activation of AtMEK5 in Arabidopsis. Cell Research. 2008; 18: 422-432.
38. Zhang M, Wu H, Su J, Wang H, Zhu Q, Liu Y, et al. Maternal control of embryogenesis by MPK6 and its upstream MKK4/MKK5 in Arabidopsis. The Plant journal for cell and molecular biology. 2017; 92: 1005-1019.
39. Symons GM, Davies C, Shavrukov Y, Dry IB, Reid JB, Thomas MR. Grapes on steroids. Brassinosteroids are involved in grape berry ripening. Plant physiology. 2006; 140: 150-158.
40. Inaba A, Ishida M, Sobajima Y. Changes in Endogenous Hormone Concentrations during Berry Development in Relation to the Ripening of Delaware Grapes. Journal of the Japanese Society for Horticultural Science. 1976; 45: 245-252.
41. Zhang M, Yuan B, Leng P. Cloning of 9-cis-epoxycarotenoid dioxygenase (NCED) gene and the role of ABA on fruit ripening. Plant signaling & behavior. 2009; 4: 460-463.
42. Chervin C, El-kereamy A, Roustan JP, Latche A, Lamon J, Bouzayen M. Ethylene seems required for the berry development and ripening in grape, a non-climacteric fruit. Plant Science. 2004; 167: 1301-1305.
43. Novikova GV, Moshkov IE, Smith AR, Hall MA. The effect of ethylene on MAPKinase-like activity in Arabidopsis thaliana. FEBS letters. 2000; 474: 29- 32.
44. Ouaked F, Rozhon W, Lecourieux D, Hirt H. A MAPK pathway mediates ethylene signaling in plants. The EMBO journal. 2003; 22: 1282-1288.

Download PDF

Citation:Hodaei A, Werbrouck S and Çakir B. Expression Analysis of Mitogen-Activated Protein Kinases (MAPKs) Gene Family in Grapevine Berries. Ann Agric Crop Sci. 2021; 6(8): 1103.

Home

Journal Scope

editorial Board

Instruction for Authors

Submit Your Article

Contact Us