Multiple Introduction Events of Cultivated Diospyros Kaki L. of and Native Diospyros Species in Taiwan Inferred by Low Copy Nuclear Markers

Special Article: Plant Biology

Ann Agric Crop Sci. 2023; 8(4): 1140.

Multiple Introduction Events of Cultivated Diospyros Kaki L. of and Native Diospyros Species in Taiwan Inferred by Low Copy Nuclear Markers

Kuan-ting Hsin1#; Ya-Ling Chang5,3#; Chun-Neng Wang1; Jui-Sheng Lai2; Ching-Chang Shiesh3; Huey-Ling Lin3,4*

1Department of Life Science, College of Life Science, National Taiwan University, Taiwan

2Miaoli District Agricultural Research and Extension Station, Council of Agricultural, Taiwan

3Department of Horticulture, National Chung Hsing University, Taiwan

4Department of Horticulture and Innovation and Development Center of Sustainable Agriculture (IDCSA), National Chung Hsing University, Taiwan

5Miaoli District Agricultural Research and Extension Station, Ministry of Agriculture, Taiwan

*Corresponding author: Huey-Ling Lin Department of Horticulture, National Chung Hsing University, 145, Xingda Road, Taichung 40227, Taiwan. Tel: +886-4-22840340; Fax: +886-4-22860574 Email: hllin@dragon.nchu.edu.tw

#These authors have contributed equally to this article.

Received: July 31, 2023 Accepted: August 22, 2023 Published: August 29, 2023

Abstract

Diospyros kaki L. is one of the most important fruits in Taiwan. Cultivated D. kaki cultivars are classified into four types, according to their loss of astringency in ripening fruit and their change in flesh color, namely the Pollination-Constant Non-Astringent (PCNA), the Pollination Variant Non-Astringent (PVNA), the Pollination Variant Astringent (PVA) and the Pollination Constant Astringent (PCA). Recently, persimmon breeders are paying more attention to rootstock selection for successful grafting and agricultural production. To identify suitable rootstock and to trace the origins of extant native Diospyros species in Taiwan, the 10 known native Diospyros species together with four D. kaki cultivars were analyzed by using two low-copy, nuclear-encoded DNA markers, ncpGS and PHYA. There was moderate to strong support for the major nodes within the phylogenetic tree, obtained from both the Maximum-likelihood or the Bayesian inference methods. The constructed D. kaki phylogeny using Maximum Likelihood (ML) and Bayesian Inference (BI) algorithms formed three clades. The most basal clade (clade A) comprised species distributed in the South East Asia , then species distributed in East Asia (clade B), and then D. kaki cultivars (clade C). The extant native Taiwan Diospyros species nested into clade A and B, suggesting a northward migration pattern of native Taiwan Diospyros species. In addition, the species D. oldhamii formed a sister clade with the D. kaki cultivars, suggesting that D. oldhamii may be a compatible rootstock. Lastly, D. kaki cultivars sampled from growers that were acquaintances formed corresponding subclades within clade C (C-1, C-2 and C-3), suggesting a high discrimination ability of the ncpGS and PHYA molecular markers used here.

Keywords: Diospyros kaki, ncpGS, PhyA, phylogeny, persimmon

Introduction

The Diospyros genus contains over 500 species, making it the largest genus in the Ebenaceae family [1]. The members of genus Diospyros are distributed broadly from tropical to temperate regions. Most Diospyros species are distributed in Asia and the Pacific, making Asia and Oceania its center of diversity [2]. Some species are well known for their edible fruits, such as D. kaki, D. lotus and D. virginiana [3,4], while other species are famous for their timber, like D. ebenum, D. mollis and D. dendo. Moreover, leaves and fruits of some Diospyros species have been used as medicine, e.g. D. kaki and D. lotus [5,6].

D. kaki is the most economically important and widely cultivated species in the world. Cultivars of D. kaki are grown in Australia, Brazil, China, Iran, Israel, Italy, Japan, New Zealand, and United States of America [7,8]. The geographical origin of the D. kaki species is not yet known. However, wild D. kaki plants have been observed in forests in China, so D. kaki is believed to have originated in China [9]. According to features of the mature fruit (astringency due to tannins, presence of seeds), cultivars are classified into four types, namely 1) Pollination-Constant Non-Astringent (PCNA), 2) Pollination-Variant Non-Astringent (PVNA), 3) pollination-variant astringent (PVA) and 4) Pollination-Constant Astringent (PCA) [9] (Figure 1). Among these four types, the PCNA and PVNA types lose astringency naturally during fruit growth and become edible at maturity, while PVA and PCA types retain astringency at maturity. Further, in the PVNA cultivars, sufficient pollination can enhance the loss of astringency, but insufficient pollination will make the fruits retain astringency at maturity but may be edible when softened. In contrast, PCNA fruit consistently loses its astringency during fruit development, regardless of pollination efficiency. PCNA-type cultivars are important for commercial production of persimmon worldwide since the fruits lose their astringency naturally and do not require post-harvest astringency processing.

Figure 1: Four types of Diospyros kaki cultivars based on fruit classification. (a). Diospyros kaki cv. Fuyu, PCNA type. Fruit will be sweet whether hard or soft (b). Diospyros kaki cv. Fudegaki, PVNA. Unseeded fruit must soften after harvest to be sweet (c). Diospyros kaki cv. Hirataneanshi, PVA. Fruit remains astringent, except near seeds. (d). Diospyros kaki cv. Bull Heart, PCA. Fruit must become soft to be edible.


    


    

    


    


    Figure 1: Four types of Diospyros kaki cultivars based on fruit classification. (a). Diospyros kaki cv. Fuyu, PCNA type. Fruit will be sweet whether hard or soft (b). Diospyros kaki cv. Fudegaki, PVNA. Unseeded fruit must soften after harvest to be sweet (c). Diospyros kaki cv. Hirataneanshi, PVA. Fruit remains astringent, except near seeds. (d). Diospyros kaki cv. Bull Heart, PCA. Fruit must become soft to be edible.

Previous phylogenetic studies revealed that two species distributed in Asia, Diospyros glandulosa (2n=2x=30) and Diospyros oleifera (2n=2x=30), are most likely ancestors of D. kaki (2n= 6x= 90) [2,7,8]. Their phylogenies also suggested that D. kaki originated in Asia through polyploidization. Although the cultivar development history is not yet clear, it is proposed that the PCA-type cultivars are thought to have appeared first in China, and then split into PVA-PVNA and PCNA lineages in Japan [10]. According to this hypothesis, PCNA-type accessions exhibit a single origin from a PCA-type progenitor. However, molecular evidence showed multiple origins of both PCNA and non-PCNA types [11]. For example, PCNA-type cultivars in Japan and in China formed clades respectively [11]. Non-PCNA type cultivars in Japan also exhibit paraphyly in their phylogeny [11]. To conclude, the multiple origin hypothesis of PCNA and non-PCNA cultivars in Asia is more likely than a single origin hypothesis as proposed by [10].

Due to lack of sterility of seeds, D. kaki is propagated via grafting of propagated scions onto wild rootstocks. The commonly used rootstocks include D. kaki, D. lotus and D. virginiana [12,13]. In Taiwan, the most common rootstock for D. kaki cultivars is D. japonica. It has been proposed that a closer genetic relationship between scion and rootstock is associated with higher grafting success [14].

There are 10 Diospyros species identified in Taiwan, including Diospyros ferrea, Diospyros japonica, Diospyros kotoensis, Diospyros morrisiana, Diospyros philippensis, Diospyros eriantha, Diospyros vaccinioides, Diospyros maritima, Diospyros oldhamii and Diospyros rhombifolia [15]. By analyzing Random Amplified polymorphic DNA (RAPD) markers, D. kaki clustered with D. oldhamii and D. japonica, suggesting that D. oldhamii and D. japonica may be potentially compatible rootstocks for grafting. However, the genetic relationship among D. kaki cultivars and other native Diospyros species remains unclear.

To reconstruct a phylogeny of closely related taxa or within the same species, low copy nuclear markers are preferable than commonly used non-coding cpDNA markers that have a high genetic variability [16]. For example, eight chloroplast markers, comprising over 8000 bases, were sequenced to resolve the relationship of Diospyros species from New Caledonian, Hawaii and islands in the Indian Ocean [17]. However, low variability and little resolution were shown among those target Diospyros species in their phylogeny. In contrast, two nuclear markers, chloroplast-expressed glutamine synthetase (ncpGS) and phytochrome A (PHYA), comprising about 1900 bases, were be able to resolve the relationship among those New Caledonian, Hawaii and Indian ocean Diospyros species [2]. Thus, ncpGS and PHYA are more satisfactory genetic markers in drawing the relationships among native Diospyros species and cultivars in Taiwan.

In this study, we aimed to define 1) the relationship among native Diospyros species in Taiwan and 2) the relationship among D. kaki cultivars. Two low-copy nuclear markers, ncpGS and PHYA, were isolated from the target species to draw the phylogenetic relationship among the native Diospyros species and the D. kaki cultivars in Taiwan.

Materials and Methods

DNA Extraction, Molecular Marker Amplification and Sequencing

Genomic DNA from 56 samples Diospyros species and cultivars (Table 1) was extracted from leaf samples dried in silica gel following a CTAB method (Doyle & Doyle, 1987). Two nuclear-encoded genes (PHYA and the chloroplast-expressed glutamine synthetase,e ncpGS) were sequenced for phylogeny reconstruction [2]. Initial PCR products of PHYA and ncpGS were obtained using primer pairs from [19,20], respectively. As these primers were not specifi c enough, we sliced the major PCR products from agarose gels and sequenced the major PCR products to be able to design Diospyros-specifi c PHYA PCR primers (phyA_F: GAGCTTGGAAAGGCTTTGTG; phyA_R: CAGCTGCCATCCCACATACT) and ncpGS PCR primers (ncpGS_F: TTCTTGGTCTGGTAGTGGGAAT; ncpGS_R: TGCTTTTTCTAGTCTCGGTATGC).

Table 1: Sequences of Diospyros species and D. kaki cultivars used in this study.










  


    
Taxon


    
collection site


    
Collection codes


    
Accession no. for ncpGS


    
Accession no. for PHYA


  


  


    
Diospyros eriantha Champ. ex Benth.


    
Wufeng,    TaichungΔ


    

    
ON351647


    
ON351614


  


  


    
Diospyros    ferrea (Lour.) A.Chev.


    
Wufeng,    TaichungΔ


    

    
ON351643


    
ON351612


  


  


    
Diospyros    japonica Sieb.& Zucc.


    
Heping,    TaichungΔ


    

    
ON351670


    
ON351634


  


  


    
Diospyros    kotoensis T. Yamaz.


    
Wufeng,    TaichungΔ


    

    
ON351644


    
none


  


  


    
Diospyros    maritima Blume


    
Wufeng,    TaichungΔ


    

    
ON351645


    
ON351613


  


  


    
Diospyros    morrisiana


    
Zhongzheng,    TaipeiΔ


    

    
ON351678


    
ON351642


  


  


    
Diospyros    oldhamii


    
Anle,    KeelungΔ


    

    
ON351677


    
ON351641


  


  


    
Diospyros    philippensis (Desr.) Gürke


    
Wufeng,    TaichungΔ


    

    
ON351646


    
none


  


  


    
Diospyros    rhombifolia Hemsl.


    
Wufeng,    TaichungΔ


    

    
ON351648


    
ON351615


  


  


    
Diospyros    vaccinioides Lindl.


    
Wufeng,    TaichungΔ


    

    
ON351649


    
ON351616


  


  


    
Diospyros    andamanica


    
Thailand*


    

    
KF291447


    
KF291624


  


  


    
Diospyros    apiculata


    
Thailand*


    

    
KF291449


    
KF291626


  


  


    
Diospyros    borbonica


    
Reunion*


    

    
KF291453


    
KF291630


  


  


    
Diospyros    discolor


    
Thailand*


    

    
KF291473


    
KF291650


  


  


    
Diospyros    dictyoneura


    
Thailand*


    

    
KF291471


    
KF291648


  


  


    
Diospyros    diepenhorstii


    
Thailand*


    

    
KF291472


    
KF291649


  


  


    
Diospyros    glandulosa


    
Thailand*


    

    
KF291492


    
KF291669


  


  


    
Diospyros    kupensis


    
Cameroon*


    

    
KF291501


    
KF291678


  


  


    
Diospyros    lotus


    
Living    coll.


      Kew 1882-3501*


    

    
KF291507


    
KF291684


  


  


    
Diospyros    macrocarpa


    
New    Caledonia*


    

    
KF291509


    
KF291686


  


  


    
Diospyros    mollis


    
Thailand*


    

    
KF291522


    
KF291699


  


  


    
Diospyros    oubatchensis


    
New    Caledonia*


    

    
KF291529


    
KF291706


  


  


    
Diospyros    rhodocalyx Kurz


    
Thailand*


    

    
KF291567


    
KF291744


  


  


    
Diospyros    samoensis


    
Cult.    Hawaii Bot Garden*


    

    
KF291569


    
KF291746


  


  


    
Diospyros    sp.(Madagascar)


    
Madagascar*


    

    
KF291571


    
KF291748


  


  


    
Diospyros    texana Scheele


    
Middle    America*


    

    
KF291575


    
KF291752


  


  


    
Diospyros    venosa


    
Thailand*


    

    
KF291596


    
KF291773


  


  


    
Diospyros    virginiana L.


    
USA*


    

    
KF291612


    
KF291789


  


  


    
Diospyros    vera


    
Central    African Republic*


    

    
KF291597


    
KF291774


  


  


    
Diospyros    winitii Fletcher


    
Thailand*


    

    
KF291615


    
KF291792


  


  


    
Styrax    officinalis


    
Indonesia*


    

    
KF291623


    
KF291800


  


  


    
Euclea    undulata


    
Living    coll. HBV*


    

    
KF291620


    
KF291797


  


  


    
Diospyros    kaki cv. Amahyakume


    
Heping,    TaichungΔ


    
G21


    
ON351663


    
ON351627


  


  


    
Diospyros kaki cv. Aoso


    
Heping,    TaichungΔ


    
G18


    
ON351660


    
none


  


  


    
Diospyros    kaki cv. Bull Heart


    
Kungkuan,    MiaoliΔ


    
G08


    
ON351650


    
ON351617


  


  


    
Diospyros    kaki cv. Diamond Bull Heart


    
Heping,    TaichungΔ


    
G11


    
ON351653


    
ON351619


  


  


    
Diospyros    kaki cv. Fudegaki


    
Dongshi,    TaichungΔ


    
G09


    
ON351651


    
none


  


  


    
Diospyros    kaki cv. Fuyu


    
Heping,    TaichungΔ


    
G25


    
ON351667


    
ON351631


  


  


    
Diospyros    kaki cv. Fuyu


    
Heping,    TaichungΔ


    
G19


    
ON351661


    
ON351625


  


  


    
Diospyros    kaki cv. Fuyu


    
Heping,    TaichungΔ


    
G17


    
ON351659


    
ON351624


  


  


    
Diospyros    kaki cv. Fuyu


    
Sinyi,    NantouΔ


    
G23


    
ON351665


    
ON351629


  


  


    
Diospyros    kaki cv. Fuyu


    
Heping,    TaichungΔ


    
G22


    
ON351664


    
ON351628


  


  


    
Diospyros    kaki cv. Fuyu


    
Heping,    TaichungΔ


    
G29


    
ON351671


    
ON351635


  


  


    
Diospyros    kaki cv. Fuyu


    
Dongshi,    TaichungΔ


    
G10


    
ON351652


    
ON351618


  


  


    
Diospyros kaki cv. Hana-gosho


    
Heping,    TaichungΔ


    
G16


    
ON351658


    
none


  


  


    
Diospyros    kaki cv. Hirataneanshi


    
Wufeng,    TaichungΔ


    
G13


    
ON351655


    
ON351621


  


  


    
Diospyros    kaki cv. Maekawa-Jirow


    
Sinyi,    NantouΔ


    
G24


    
ON351657


    
ON351623


  


  


    
Diospyros    kaki cv. Maekawa-Jirow


    
Heping,    TaichungΔ


    
G15


    
ON351666


    
ON351630


  


  


    
Diospyros    kaki cv. Soshu


    
Heping,    TaichungΔ


    
G14


    
ON351656


    
ON351622


  


  


    
Diospyros    kaki cv. Syh Jou


    
Dongshi,    TaichungΔ


    
G12


    
ON351654


    
ON351620


  


  


    
Diospyros    kaki cv.Taishuu


    
Sinyi,    NantouΔ


    
G26


    
ON351662


    
ON351626


  


  


    
Diospyros    kaki cv.Taishuu


    
Heping,    TaichungΔ


    
G20


    
ON351668


    
ON351632


  


  


    
Diospyros    kaki cv. Fuyu


    
Wufeng,    HsinchuΔ


    
C017


    
ON351671


    
ON351635


  


  


    
Diospyros    kaki cv. Fuyu


    
Wufeng,    HsinchuΔ


    
C019


    
ON351672


    
ON351636


  


  


    
Diospyros    kaki cv. Fuyu


    
Wufeng,    HsinchuΔ


    
J26


    
ON351673


    
ON351637


  


  


    
Diospyros    kaki cv. Fuyu


    
Wufeng,    HsinchuΔ


    
G44


    
ON351675


    
ON351639


  


  


    
Diospyros    kaki cv.Tonewase


    
Heping,    TaichungΔ


    
G27


    
ON351669


    
ON351633


  


  


    
Δ: sequences obtained in this study. *: sequences obtained from Turner    et al. (2013). 


  


















Table 1: Sequences of Diospyros species and D. kaki cultivars used in this study.

The PCR reactions were made up to a total volume of 25 μl, containing 13 μl of 2x Ampliqon master mix Red (Ampliqon, Denmark), 0.25 μl each primer at 2 μM, 10.5 μl ddH2O and 1 μl template DNA at 20 ng/μl. The PCR profile for amplification of both the PHYA and ncpGS markers was an initial denaturing for 3 min at 94°C followed by 37 cycles of 30 s at 94°C, 30 s at 56°C, and 1 min at 72°C with a final extension for 10 min at 72°C, . All PCR products were examined by 1.0% (w/v) agarose gel electrophoresis, and then the band of the expected size was sent for sequencing by ABI 3700 automatic sequencer (manufacturer). All sequences were examined by Sequence Scanner v1.0 first and then aligned for phylogenetic reconstruction.

Phylogeny Reconstruction

The sequences of PHYA and ncpGS of the native Diospyros species in Taiwan were used as an outgroup, considering the close phylogenetic relationship of native species to cultivars. In addition, representatives of genus Diospyros were chosen based on [2] (Details see Table 1). The sequences were automatically aligned using MUSCLE [21] in MEGA v.6 [22]. After alignment, the PHYA and ncpGS datasets were concatenated to obtain all genetic information of these two nuclear markers. For both Maximum Likelihood (ML) and Bayesian Inference (BI) phylogeny, the web interface PhyML 3.0 was applied [23]. The best-fit nucleotide substitution model of each dataset was evaluated by Smart Model Selection (SMS), which was implementing in PhyML 3.0 [24]. The GTR + G model was also the best-fit model for concatenated PHYA and ncpGS dataset. The phylogeny is visualized in FigTree v1.4.3. [25].

Results

Relationships of Diospyros Species and Cultivars in Taiwan

To infer the relationships among the native Taiwan Diospyros species and the currently grown Diospyros kaki cultivars, we reconstructed the phylogeny using sequences isolated from the target species (number of samples) as well as sequences obtained from the NCBI database of other Diospyros species (listed in Table 1, number of dB data). Only nodes with a Maximum Likelihood (ML) and Bayesian Inference (BI) probability value over 0.7 (BI>0.7 or aLRT > 0.7) were regarded as a reliable clade. According to our criteria, the native Taiwan Diospyros species were distributed into two clades (Figure 2). Sequences of D. philippensis and D. kotoensis were grouped with published sequences from species originating in Indo-China, Indonesia and Philippines (Figure 2, Clade A; BI: 0.98, aLRT: 1), while D. ferrea, D. rhombifolia, D. maritime, D. eriantha, D. vaccinioides, D. morrisiana, D. japonica and D. oldhamii grouped together (Figure 2, Clade B; BI: 1, aLRT: 1). All D. kaki cultivars formed a single clade, topologically the sister clade of D. oldhamii (Figure 2, clade C). D. japonica is a Taiwan native persimmon species used as the rootstock of D. kaki cv. Fuyu. The test results showed that D. kaki cv. Fuyu was closely related to cv. Aoso. On the other hand, the native Taiwan persimmon species D. oldhamii is closely related to D. kaki cv. Fuyu, while D. kaki cv. Fuyu is distantly related to D. japonica.

Figure 2: Phylogeny inferred from PHYA and ncpGS sequences. Numbers above a branch represent posterior probability estimated using Bayesian Inference (BI) algorithm; Numbers below a branch represent the value estimated using Maximum Likelihood (ML) algorithm. Species name colored in red represent native Diospyros species distributed in Taiwan. Light blue squares denote Diospyros species distributed in South East Asia; Blue squares denote Diospyros species distributed in East Asia; Green squares denote Diospyros species distributed in Taiwan. Red circle represents PCNA-type cultivars; green circle represents PCA-type cultivars; blue represents PVNA-cultivars; and yellow represents PVA-type cultivars.


    


    

    


    


    Figure 2: Phylogeny inferred from PHYA and ncpGS sequences. Numbers above a branch represent posterior probability estimated using Bayesian Inference (BI) algorithm; Numbers below a branch represent the value estimated using Maximum Likelihood (ML) algorithm. Species name colored in red represent native Diospyros species distributed in Taiwan. Light blue squares denote Diospyros species distributed in South East Asia; Blue squares denote Diospyros species distributed in East Asia; Green squares denote Diospyros species distributed in Taiwan. Red circle represents PCNA-type cultivars; green circle represents PCA-type cultivars; blue represents PVNA-cultivars; and yellow represents PVA-type cultivars.

According to the classification based on fruit characteristics, D. kaki is divided into four types: PCNA, PVNA, PVA, and PCA. The two sampled PVNA types formed a single clade, namely D. kaki cv. Amahyakume and D. kaki cv. Fudegaki. It is noteworthy that the PCNA, PVA, and PCA types of D. kaki did not form single clades based on fruit ripening characteristics. PCNA types were distributed among at least four subclades within clade C, within which both PCA and PVA types were also nested.

Fuyu is the most grown cultivar in Taiwan and forms three subclades within clade C, namely C-1, C-2, and C-3 (Figure 2). Fuyu samples G19, J26, C019, C017, and G44 are in subclade C-1 and were collected from Heping District, Taichung City (G19) and Wufeng Township, Hsinchu County (J26, C019, C017, and G44), respectively. Samples G23, G25, and G10 are subclades of Clade C-2 and were collected from Xinyi Township (G23 and G25), Nantou County and Dongshi District, Taichung City (G10), while G17 and G29 are in subclade C-3 and were both collected from Heping District, Taichung City, but cultivated by different farmers.

Discussion

By sampling all known native Diospyros species and the most widely grown D. kaki cultivars in Taiwan, we reconstructed a comprehensive phylogeny which allowed the inference of two potential dispersal routes of native Diospyros species and indicted that multiple introduction events of cultivated D. kaki cultivars had occurred. Native Taiwan Diospyros species formed two distinct clades, including the South East Asia clade and the East Asia clade (Figure 2 & Table 2). In addition, the East Asia clade nested within the South East Asia clades. Extant native Diospyros species in Taiwan within these two clades may hint that these species in Taiwan entered their current habitat through two colonization routes. The evidence showing that the East Asia clades nested within the South East Asia clade indicates that a dispersal route from Indo-China through the Asian continent to Taiwan is likely. A second dispersal route would have been through the Philippine Archipelago to Taiwan. The Quaternary, glacial and inter-glacial periods, caused by climatic oscillation, lead to repeated lowering and raising of sea levels in East Asia [26,27]. During a glacial period, submerged sea floor may have be exposed due to lower sea levels, forming land bridges connecting isolated landmass [28]. Land bridges provide opportunity allowing terrestrial plant species to migrate between the Asian mainlands and adjacent islands, like Taiwan and Japan. For example, a haplotype (H9) of Quercus variabilis was identified from both the Asia continent and some adjacent islands (including Taiwan and Japan), suggesting plant migration through land bridges [29]. The phylogeny of some herbaceous plants also support landbridging. Lysionotus pauciflorus exhibits similar distribution pattern to Q. variabilis, inhabiting the Asia continent and adjacent islands [30]. and a, few individuals from both Asia and adjacent islands formed a monophyletic clade with a calculated time of divergence during the maximal glacial period [30]. In our study, Diospyros species belonging to the East Asia clade (including D. maritima, D. eriantha, D. vaccinioides, D. morrisiana, D. japonica and D. oldhamii) were distributed in both the Asia continent and the adjacent islands of Taiwan and Japan), suggesting migration through exposed East Asia seafloor likely. The aforementioned second possible dispersal route through the Philippine archipelago to Taiwan has no historical geological event (glacial-interglacial period) that connected the Philippine archipelago and Taiwan [31], making dispersal from the Philippine archipelago through a land bridge to Taiwan unlikely. One possible scenario is through human activity. In South East Asia, Austronesian-speaking people migrate among islands using boats. To build a reliable boat, solid timber is necessary. Austronesian-speaking people in Taiwan, like the Tao people in Lanyu, use timber from D. philippensis to build a boat [32]. Austronesian-speaking people carrying necessary and useful plants with them is traceable. For example, paper mulberry (Broussonetia papyrifera) was carried by Austronesian-speaking people for its bark [33,34]. Molecular phylogeny conducted using cpDNA of B. papyrifera offers genetic evidence supporting the transport of this species by Austronesian-speaking people [35]. the migratory transport of D. philippensis by Austronesian-speaking people requires further study.

Table 2: Distribution range of native Diospyros species in Taiwan.










  


    
Species


    
Distribution range


  


  


    
Diospyros    eriantha


    
China    to Nansei-shoto and W. & Central Malesia, Taiwan


  


  


    
Diospyros    ferrea


    
Tropical    Africa to SW. Pacific.


  


  


    
Diospyros    japonica


    
S.    China, Central & S. Japan to Nansei-shoto, Taiwan


  


  


    
Diospyros    kotoensis


    
Taiwan


  


  


    
Diospyros    maritima


    
China    (Yunnan) to Nansei-shoto and N. Australia, Taiwan


  


  


    
Diospyros    morrisiana


    
Central & S. Japan to SE. China,    Taiwan


  


  


    
Diospyros    oldhamii


    
Nansei-shoto    to Central & E. Taiwan.


  


  


    
Diospyros philippensis


    
E. & S. Taiwan to E. Borneo


  


  


    
Diospyros rhombifolia


    
SE. China, Taiwan


  


  


    
Diospyros vaccinioides


    
China (Guangxi, Guangdong) to Hainan, Taiwan


  


















Table 2: Distribution range of native Diospyros species in Taiwan.

Taxonomy and genetic affinity are prerequisites for grafting affinity [15]. The greater the genetic distance between the rootstock and the scion, the lesser the chance of forming a successful graft union [36,37]. To achieve a successful grafting combination, the genetic distance between the two ranks as intraclonal > interclonal > intraspecific > interspecific > intrageneric > intergeneric > intrafamilial [38]. An autografted combination between rootstock and scion indicates close similarity in their taxonomy and a good affinity. If the rootstock and scion are different species but belong to the same genus, the graft is more or less compatible. While graft combinations are generally rarely compatible, those between families are incompatible and unsuccessful [39]. D. lotus was used as the rootstock for cultivating persimmon in California, whose grafting incompatibility resulted in dwarfism and came into bearing early of persimmon, and declined within a few years. On the other hand, D. virginiana, native to the United States, is an ideal rootstock for persimmon. Compared with D. lotus and D. virginiana, the parent species of cultivated persimmon, D. kaki is even more compatible with grafting [40].

The relationships of 19 kiwifruit species were analyzed through the chloroplast genome. The greater the pairwise genetic distance between the rootstock (Actinidia deliciosa) and the xenografted kiwifruit, the lower the survival rate of the scion [15]. In this study, the sequencing of two marker genes confirmed that D. kaki, D. japonica, cultivar Aoso, and D. oldhamii belong to the same genus. It also confirmed that D. kaki and cultivar Aoso are the same species. Considering their close kinship, D. oldhamii and D. kaki may show a better affinity after grafting, and D. oldhamii should be tested for agricultural use as a rootstock in the Taiwan persimmon industry.

It is hypothesized that PCA-type cultivars of D. kaki are first in China, and then split into the PVA-PVNA type and PCNA lineages in Japan [10]. However, this is not supported by recent molecular studies [7,9,11]. An extensive analysis of the genetic diversity of 146 D. kaki cultivars, obtained from China, Korea and Japan, was surveyed with 496 distinct AFLP markers [1]. By using clustering algorithm, these 146 cultivars were assigned into three clusters corresponding to geological regions. In addition, relationships among the studied D. kaki cultivars did not follow horticultural classification [11]. According to molecular data, the primary character separating them appears to be their origin instead of their astringency level. In our study, extant D. kaki cultivars in Taiwan exhibit polyphyly (Figure 2), similar to previous studies [7,9,11,41]. Unlike PCNA-type cultivars forming a monophyletic clade in previous studies, PCNA-type cultivars in Taiwan formed at least three sub-clades (Figure 2). These three sub-clades may suggest at least three origins of Taiwanese PCNA-type D. kaki cultivars. One possible reason behind multiple origins may associate with human behavior, e.g. scion sharing among farmers, since Grafting is the only way to grow cv. Fuyu. In subclade C-1, G19 was collected from Heping, Taichung, but others (including C019, C017 and G44) were collected 100 km away in Wufeng, Hsinchu. After consulting local farmers, samples collected from Wufeng originated from farmers in Heping. Scion sharing could also be found in the C-2 and C-3 sub-clades. Within the C-2 sub-clade, samples G10 (Dongshi, Taichung), G23 and G25 (Sinyi, Nantou) are close to each other. Lastly, G17 and G29 were collected from Heping, Taichung and are grown by acquaintances. To conclude, sequencing of the genes ncpGS and PhyA is able to identify the origin of D. kaki cv. Fuyu cultivars in Taiwan.

References

  1. Duangjai S, Wallnöfer B, Samuel R, Munzinger J, Chase MW. Generic delimitation and relationships in Ebenaceae sensu lato: evidence from six plastid DNA regions. Am J Bot. 2006; 93: 1808-27.
  2. Turner B, Munzinger J, Duangjai S, Temsch EM, Stockenhuber R, Barfuss MHJ, et al. Molecular phylogenetics of New Caledonian Diospyros (Ebenaceae) using plastid and nuclear markers. Mol Phylogenet Evol. 2013; 69: 740-63.
  3. Heywood V, Brummitt CA, Seberg O. Flowering plant families of the World 2007.
  4. Wallnöfer B. The biology and systematics of Ebenaceae: a review. Annalen Naturhistorischen Museums Wien S B Bot Zool. 2001; 103: 485-512.
  5. Rauf A, Uddin G, Siddiqui BS, Muhammad N, Khan H. Antipyretic and antinociceptive activity of Diospyros lotus L. in animals. Asian Pac J Trop Biomed. 2014; 4: S382-6.
  6. Xie C, Xie Z, Xu X, Yang D. Persimmon (Diospyros kaki L.) leaves: a review on traditional uses, phytochemistry and pharmacological properties. J Ethnopharmacol. 2015; 163: 229-40.
  7. Yonemori K, Kanzaki S, Honsho C, Akagi T, Parfitt DE. Phylogeny and cultivar development of Diospyros kaki: a survey based on molecular analyses. Adv Hortic Sci. 2008; 22: 261-8.
  8. Yesiloglu T, Çimen B, Incesu M, Yilmaz B. Genetic diversity and breeding of persimmon; 2018.
  9. Yonemori K, Sugiura A, Yamada M. Persimmon genetics and breeding. Plant Breed Rev. 2000; 19: 191-225.
  10. Kanzaki S. The Origin and Cultivar Development of Japanese persimmon (Diospyros kaki Thunb.). Nippon Shokuhin Kagaku Kogaku Kaishi. 2016; 63: 328-30.
  11. https://link.springer.com/article/10.1007/s11295-015-0848-z
  12. Izhaki A, Yitzhak Y, Blau T, David I, Rotbaum A, Riov J, et al. Rooting of cuttings of selected Diospyros virginiana clonal rootstocks and bud growth in rooted cuttings. Sci Hortic. 2018; 232: 13-21.
  13. Yakushiji H, Sugiura H, Yamasaki A, Azuma A, Koshita Y. Tree growth, productivity, and fruit quality of ’Fuyu’ persimmon trees onto different dwarfing rootstocks. Sci Hortic. 2021; 278.
  14. Li D, Han F, Liu X, Lv H, Li L, Tian H, et al. Localized graft incompatibility in kiwifruit: analysis of homografts and heterografts with different rootstock & scion combinations. Sci Hortic. 2021; 283: 110080.
  15. Lu S-Y. Yang y-p. A revision of the Ebenaceae of Taiwan. 1988; 3: 131-40.
  16. Krak K, Álvarez I, Caklová P, Costa A, Chrtek J, Fehrer J. Development of novel low-copy nuclear markers for Hieraciinae (Asteraceae) and their perspective for other tribes. Am J Bot. 2012; 99: e74-7.
  17. Duangjai S, Samuel R, Munzinger J, Forest F, Wallnöfer B, Barfuss MHJ, et al. A multi-locus plastid phylogenetic analysis of the pantropical genus Diospyros (Ebenaceae), with an emphasis on the radiation and biogeographic origins of the New Caledonian endemic species. Mol Phylogenet Evol. 2009; 52: 602-20.
  18. Wolfe KH, Li WH, Sharp PM. Rates of nucleotide substitution vary greatly among plant mitochondrial, chloroplast, and nuclear DNAs. Proc Natl Acad Sci U S A. 1987; 84: 9054-8.
  19. Mathews S, Donoghue MJ. The root of angiosperm phylogeny inferred from duplicate phytochrome genes. Science. 1999; 286: 947-50.
  20. Yockteng R, Nadot S. Phylogenetic relationships among Passiflora species based on the glutamine synthetase nuclear gene expressed in chloroplast (ncpGS). Mol Phylogenet Evol. 2004; 31: 379-96.
  21. Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004; 32: 1792-7.
  22. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013; 30: 2725-9.
  23. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol. 2010; 59: 307-21.
  24. Lefort V, Longueville JE, Gascuel O. SMS: smart model selection in PhyML. Mol Biol Evol. 2017; 34: 2422-4.
  25. Rambaut A. FigTree v1. 2012; 4.
  26. Ohmura A, Shi Y, editors. The Quaternary glaciations and environmental variations in China. J Glaciol. 2007. ISBN 7 5375 3247 8, hardback. 190.00 yuan. 2006: 53: 518.
  27. Zheng Y, Yu G, Wang S, Xue B, Liu H, Zeng X. Simulations of LGM climate of East Asia by regional climate model. Sci China Ser D-Earth Sci. 2003; 46: 753-64.
  28. Osozawa S, Shinjo R, Armid A, Watanabe Y, Horiguchi T, Wakabayashi J. Palaeogeographic reconstruction of the 1.55 Ma synchronous isolation of the Ryukyu Islands, Japan, and Taiwan and inflow of the Kuroshio warm current. Int Geol Rev. 2012; 54: 1369-88.
  29. Chen D, Zhang X, Kang H, Sun X, Yin S, Du H, et al. Phylogeography of Quercus variabilis based on chloroplast DNA sequence in East Asia: multiple glacial refugia and mainland-migrated island populations. PLOS ONE. 2012; 7: e47268.
  30. Kokubugata G, Hirayama Y, Peng C-I, Yokota M, Möller M. Phytogeographic aspects of Lysionotus pauciflorussensu lato (Gesneriaceae) in the China, Japan and Taiwan regions: phylogenetic and morphological relationships and taxonomic consequences. Plant Syst Evol. 2011; 292: 177-88.
  31. Voris HK. Maps of Pleistocene sea levels in Southeast Asia: shorelines, river systems and time durations. J Biogeography. 2000; 27: 1153-67.
  32. Hung SF, Roan SF, Chang TL, King HB, Chen IZ. Analysis of aroma compounds and nutrient contents of mabolo (Diospyros blancoi A. DC.), an ethnobotanical fruit of Austronesian Taiwan. J Food Drug Anal. 2016; 24: 83-9.
  33. Matisoo-Smith EA. Tracking Austronesian expansion into the Pacific via the paper mulberry plant. Proc Natl Acad Sci U S A. 2015; 112: 13432-3.
  34. Wu C, Rolett B. Prehistoric maritime cultures and seafaring in east Asia. 2019.
  35. Payacan C, Moncada X, Rojas G, Clarke A, Chung KF, Allaby R, et al. Phylogeography of herbarium specimens of asexually propagated paper mulberry [Broussonetia papyrifera (L.) L’Hér. ex Vent. (Moraceae)] reveals genetic diversity across the Pacific. Ann Bot. 2017; 120: 387-404.
  36. Dogra K, Kour K, Kumar R, Bakshi P, Kumar V. Graft-incompatibility in horticultural crops. Int J Curr Microbiol Appl Sci. 2018; 7: 1805-20.
  37. Rasool A, Mansoor S, Bhat KM, Hassan GI, Baba TR, Alyemeni MN, et al. Mechanisms underlying graft union formation and rootstock scion interaction in horticultural plants. Front Plant Sci. 2020; 11: 590847.
  38. Andrews PK, Graft SM C. Incompatibility. Hortic Rev. 1993: 183-232.
  39. Mudge K, Janick J, Scofield S, Goldschmidt EE. A history of grafting. Hortic Rev. 2009: 437-93.
  40. Hodgson RM. Rootstocks for the oriental persimmon. Proc Am Soc Hortic Sci. 1939; 37: 338-9.
  41. Yonemori K, Honsho C, Kanzaki S, Ino H, Ikegami A, Kitajima A, et al. Sequence analyses of the ITS regions and the matK gene for determining phylogenetic relationships of Diospyros kaki (persimmon) with other wild Diospyros (Ebenaceae) species. Tree Genet Genomes. 2008; 4: 149-58.

Citation:Hsin KT, Chang YL, Wang CN, Lai JS, Shiesh CC, et al. Multiple Introduction Events of Cultivated Diospyros Kaki L. of and Native Diospyros Species in Taiwan Inferred by Low Copy Nuclear Markers. Ann Agric Crop Sci. 2023; 8(4): 1140.