Low Prevalence of Mycoplasma pneumoniae and Chlamydia pneumoniae in Children Hospitalized for Acute Respiratory Infection in Burkina Faso

Research Article

J Bacteriol Mycol. 2019; 6(5): 1116.

Low Prevalence of Mycoplasma pneumoniae and Chlamydia pneumoniae in Children Hospitalized for Acute Respiratory Infection in Burkina Faso

Sanou AM1*, Wandaogo SCM1, Cissé A1, Sagna T1, Ouedraogo MS2, Hübschen JM3, Nacro B4, Snoeck CJ3 and Tarnagda Z1

1National Influenza Reference Laboratory, Institut de Recherche en Sciences de la Santé, Bobo-Dioulasso, Burkina-Faso

2Service de Médecine Interne, Centre Hospitalier Universitaire Souro Sanou, Bobo-Dioulasso, Burkina Faso, Université Nazi BONI de Bobo-Dioulasso (UNB), Bobo-Dioulasso, Burkina Faso

3Department of Infection and Immunity, Luxembourg Institute of Health, Esch-sur-Alzette, Luxembourg

4Service de Pédiatrie, Centre Hospitalier Universitaire Souro Sanou, Bobo-Dioulasso, Burkina Faso; Unité de Formation et de Recherche en Sciences de la Santé (UFR/ SDS), Université de Ouagadougou, Burkina Faso

*Corresponding author: Armel M. SANOU, National Influenza Reference Laboratory, Institut de Recherche en Sciences de la Santé, Bobo-Dioulasso, Burkina-Faso

Received: October 26, 2019; Accepted: November 27, 2019; Published: December 04, 2019

Abstract

Background: Information about Mycoplasma pneumoniae and Chlamydia pneumoniae infections in children with respiratory infections in Burkina Faso is unknown. To fill this gap, a hospital-based study investigated the prevalence of these atypical bacteria in Burkinabe children with Severe Acute Respiratory Infections (SARI).

Methods: A total of 182 Nasopharyngeal Aspirate (NPA) collected in children hospitalized for SARI between January and December 2015 were tested for Mycoplasma and Chlamydia pneumoniae by real-time PCR. Sociodemographic and clinical data were recorded using a structured questionnaire.

Results: Mycoplasma pneumoniae and Chlamydia pneumoniae was detected each in 1.6% (3/182) samples. Co-infection with other respiratory viruses was found in 83.3% (5/6) of cases.

Conclusion: This study showed a low prevalence of Mycoplasma pneumoniae and Chlamydia pneumoniae in children with SARI but confirm the circulation of these pathogens in Burkina Faso. A national surveillance is needed to determine the epidemiology of these atypical bacteria in Acute Respiratory Infections (ARIs).

Keywords: Mycoplasma pneumoniae; Chlamydia pneumoniae; Children; SARI; Burkina Faso

Bakground

Severe Acute Respiratory Infections (SARI) remains a major public health problem worldwide. It is the leading cause of childhood mortality in children under 5 years old especially in low-income countries [1]. Mycoplasma pneumoniae and Chlamydia pneumoniae are common causative agents of middle and severe respiratory infections [2,3]. Several aetiological studies reported the role of these atypical bacteria in children and adults population in Africa and elsewhere [4-8].

Being the second cause of health center’s consultation and hospitalization after malaria [9], ARI is a public health problem in Burkina Faso. Some rare studies [10-12] investigated the aetiology of ARI but very limited information is known about the role of Mycoplasma pneumoniae and Chlamydia pneumoniae infections in children. The aim of this study was to describe the epidemiology of Mycoplasma and Chlamydia pneumoniae in children with SARI in Burkina Faso by use of molecular techniques.

Methods

Study population

From January 2015 to December 2015, a hospital-based surveillance was carried out in two hospitals of Burkina Faso: the teaching hospital of Bobo-Dioulasso and the hospital of Bogodogo located in Ouagadougou. This surveillance enrolled children ≤ 5 years hospitalized for a clinical diagnosis of SARI. A SARI case was defined as “an acute respiratory infection with: history of fever or measured fever of ≥ 38°C; and cough; with onset within the last 10 days; and requires hospitalization” [13]. From each children, Nasopharyngeal Aspirates (NPA) were collected using sterile mucus extractors for NPA and placed into tubes containing Viral Transport Medium (Copan, Italy). And then, the samples were transported using the cold chain to the Virology laboratory of IRSS where they were directly aliquoted and stored at -80°C until nucleic acids extraction process. Sociodemographic and clinical data were collected using a standardized questionnaire.

Laboratory analysis

From each sample, nucleic acid was extracted using QIAamp Viral RNA Mini kit (Qiagen, Venlo, The Netherlands) according to the manufacturer’s instructions. Extracted nucleic acid were stored at –80°C before sending to the Luxembourg Institute of Health (LIH) for the molecular detection of respiratory viruses and atypical bacteria. Mycoplasma pneumoniae and Chlamydia pneumoniae were detected using previously described real time PCRs [14, 15]. Primers and PCRs conditions are summarized in Table 1.

Table 1: Primers, probes and amplification conditions for the detection of Mycoplasma pneumoniae and Chlamydia pneumoniae.





  

    
Primers/Probes

    
Sequences    (5’ – 3’)

    
Gene    Target

    
Product    size (bp)

    
Amplification    conditions

  

  

    
Mp181-F

      
 

      
Mp181-R

      
 

      
Mp181-P

    
TTTGGTAGCTGGTTACGGGAAT

      
 

      
GGTCGGCACGAATTTCATATAAG

      
 

      
TGTACCAGAGCACCCCAGAAGGGCT

    
CARDS toxin

    
73

    
95°C 10:00

      
95°C 00:15 45 cyles

      
60°C 01:00 Goto

      
3 44x 6.10°C 10:00

  

  

    
VD4_F

      
 

      
VD4_R

      
 

      
VD4_P

    
TCC-GCA-TTG-CTC-AGC-C

      
 

      
AAA-CAA-TTT-GCA-TGA-AGT-CTG-AGA-A

      
 

      
FAM-TAA-ACT-TAA-CTG-CAT-GGA-ACC-CTT-CTT-TAC-TAG-G-TAMRA

    
ompA

    
125

    
95°C 10:00

      
95°C 00:15 40 cycles

      
60°C 01:00

      
Goto 3 39x

      
10°C 10:00

  









Table 1: Primers, probes and amplification conditions for the detection of Mycoplasma pneumoniae and Chlamydia pneumoniae.

Statistical analyses

Statistical Analysis including Chi square and Fisher’s exact test were performed using STATA software version 14.0. Results were considered statistically significant for value less than 0.05.

Ethical considerations

The Institutional Ethic Committee of Centre Muraz approved the study protocol (Ethic Clearance number 13-2013/CE-CM), and the parents or legal guardians gave written informed consent prior the enrolment of children.

Results

Epidemiology

From January to December 2015, a total of 182 children ≤ 5 years hospitalized with SARI were included in this study. One hundred forty-nine (81.9%) were enrolled in the teaching Hospital (Sanou Souro) of Bobo-Dioulasso and 33 (18.1%) in the Hospital of Bogodogo, Ouagadougou. Of the 182 children, 115 (63.2%) were male with a sex ratio of 1.71. The mean age was 13.7 months ± (range: 1 to 60 months) and 147 (80.8%) children were aged less than 2 years. The main clinical symptoms included fever (76.4%), cough (86.3%), difficulty of breathing (84.6%) and indrawal costal (28.6%). Twenty four children (13.2%) had need oxygen therapy. Sociodemographic characteristics and clinical information are summarized in Table 2.

Table 2: Sociodemographic and clinical characteristics of enrolled children.





  

    
Characteristics

    
Total    of patients

      
N    = 182

      
(%)

    
Atypical    bacteria

      
N    = 6

      
(%)

  

  

    
Sex

    
 

    
 

  

  

    
Male

    
115 (63.2)

    
2

  

  

    
Female

    
67 (36.8)

    
4

  

  

    
Age    (month)

    
 

    
 

  

  

    
0 – 11

    
94 (51.6)

    
1

  

  

    
12 – 23

    
53 (29.2)

    
3

  

  

    
24 – 60

    
35 (19.2)

    
2

  

  

    
Healthcenter

    
 

    
 

  

  

    
Sanou Souro

    
149 (81.9)

    
6

  

  

    
Bogodogo

    
33 (18.1)

    
0 (0.0)

  

  

    
Symptoms

    
 

    
 

  

  

    
Fever

    
139 (76.4)

    
6

  

  

    
Cough

    
157 (86.3)

    
6

  

  

    
Dyspnea

    
154 (84.6)

    
6

  

  

    
Runny nose

    
48 (26.4)

    
2

  

  

    
Indrawal costal

    
52 (28.6)

    
1

  

  

    
Vomits

    
54 (29.7)

    
3

  

  

    
Diarrhoea

    
28 (15.4)

    
2

  

  

    
Treatment

    
 

    
 

  

  

    
Oxygen Therapy

    
24 (13.2)

    
0 (0.0)

  










Table 2: Sociodemographic and clinical characteristics of enrolled children.

Laboratory finding

Atypical bacteria infection was diagnosed in 3.3% (6/182) of NPA samples. M. pneumoniae and C. pneumoniae were detected each in 1.6 % (3/6) of samples. All pathogens were detected in children hospitalized in the teaching hospital of Bobo-Dioulasso. Most of pathogens were found in children less than 2 years (4/6, 66.66%). C. pneumoniae co-infection with respiratory viruses was observed in the 3 cases with respectively AdV, hBoV and RSV while M. pneumonia co-infection occurred in 2 cases with AdV-BoV-CoV and Influenza B respectively. The prevalent symptoms presented by children with atypical bacteria infection were fever, cough and dyspnoea.

Discussion

M. pneumoniae and C. pneumoniae are both frequently involved as causative agents in paediatric upper and lower respiratory illness [16]. They are also involved in the initiation and exacerbation of asthma in children and adults population [17, 18]. However, information about the epidemiology of these bacteria in children with ARI in Burkina Faso is lacked. This is the first report describing the role of M. pneumoniae and C. pneumoniae in children with SARI in this country. Our results showed a prevalence of 1.6% for each these bacteria. Multiples studies conducted in Africa and elsewhere with lower [6, 19-23] and higher [8, 17, 24-28] prevalence of M pneumoniae and C pneumoniae were reported. These results confirm the implication of atypical bacteria in ARI. Also, the difference of prevalence could be explained by many reasons: sampling technique, population studies, geographical region, period of study, etc. For instance, oropharyngeal swabs are the best specimens of choice to detect M. pneumoniae by PCR [23]. Moreover, a systematic review conducted in sub-Saharan African countries [29] on the aetiology of ARI in children reveal that the detection of Mycoplasma and Chlamydia pneumoniae were limited in the past due may be to the lack of high sensitive and specific diagnosis method [28].

Most of atypical bacteria was detected in children less than 2 years. This finding is in accordance with some reports of literature in which M. pneumonia and C. pneumoniae infections are common in infants and children from 1 to 5 years [8, 28]. Viral coinfection was detected in 5 of cases. In previous studies, more than 50% of cases were co-infected by viruses. [23, 29].

Conclusions

This study confirm for the first time, the circulation of Mycoplasma pneumoniae and Chlamydia pneumoniae in children with SARI in Burkina Faso. Despite their low prevalence, our finding highlight the necessity to monitor these pathogens in routine laboratory testing. In addition, further investigations in large scale are needed to determine the epidemiology of these atypical bacteria on the occurrence of respiratory infections in Burkina Faso.

Funding

This study was supported by the Ministry of Foreign and European Affairs of Luxembourg through “MAE IV project” and by the Institut de Recherche en Sciences de la Santé (IRSS).

References

  1. Nair H, et al. Global and regional burden of hospital admissions for severe acute lower respiratory infections in young children in 2010: a systematic analysis. The Lancet. 2013; 381: 1380-1390.
  2. Huong TLP, et al. First report on prevalence and risk factors of severe atypical pneumonia in Vietnamese children aged 1–15 years. BMC Public Health. 2014; 14: 1304-1312.
  3. Del Valle-Mendoza J, et al. High Prevalence of Mycoplasma pneumoniae and Chlamydia pneumoniae in Children with Acute Respiratory Infections from Lima, Peru. PLoS One. 2017; 12: e0170787.
  4. Grassi T, et al. Chlamydophila pneumoniae, Mycoplasma pneumoniae, and influenza in children with respiratory infections in Alexandria, Egypt. J Infect Dev Ctries. 2014; 8: 379-383.
  5. Touati A, et al. Prevalence of Mycoplasma pneumoniae-associated respiratory tract infections in hospitalized children: results of a 4-year prospective study in Tunis. Diagn Microbiol Infect Dis. 2010; 68: 103-109.
  6. Kim C, et al. Epidemiology of respiratory infections caused by atypical bacteria in two Kenyan refugee camps. J Immigr Minor Health. 2012; 14: 140-145.
  7. Somer A. Role of Mycoplasma pneumoniae and Chlamydia pneumoniae in Children with Community-Acquired Pneumonia in Istanbul, Turkey. Journal of Tropical Pediatrics. 2005; 52: 173-178.
  8. Zhengrong Chen Z, et al. Epidemiology and associations with climatic conditions of Mycoplasma pneumoniae and Chlamydophila pneumoniae infections among Chinese children hospitalized with acute respiratory infections. Italian Journal of Pediatrics. 2013; 39: 34-42.
  9. Annuaire MS 2015.pdf.
  10. Ouedraogo S, et al. Viral etiology of respiratory tract infections in children at the pediatric hospital in Ouagadougou (Burkina Faso). PLoS One. 2014; 9: e110435.
  11. Ouedraogo Yugbare S, et al. [Acute viral bronchiolitis in Ouagadougou (Burkina Faso)]. Arch Pediatr. 2014; 21: 1143-1144.
  12. Tarnagda Z, et al. Sentinel surveillance of influenza in Burkina Faso: identification of circulating strains during 2010-2012. Influenza Other Respir Viruses. 2014; 8: 524-529.
  13. WHO_Epidemiological_Influenza_Surveillance_Standards_2014.pdf.
  14. Tondella MLC, et al. Development and Evaluation of Real-Time PCR-Based Fluorescence Assays for Detection of Chlamydia pneumoniae. Journal of Clinical Microbiology. 2002; 40: 575-583.
  15. Winchell JM, et al. Evaluation of Three Real-Time PCR Assays for Detection of Mycoplasma pneumoniae in an Outbreak Investigation. Journal of Clinical Microbiology. 2008; 46: 3116-3118.
  16. Principi, N. and S. Esposito. Emerging role of Mycoplasma pneumoniae and Chlamydia pneumoniae in paediatric respiratorytract infections. The Lancet Infectious Diseases. 2001; 1: 334-344.
  17. Principi N, et al. Role of Mycoplasma pneumoniae and Chlamydia pneumoniae in Children with Community-Acquired Lower Respiratory Tract Infections. Clinical Infectious Diseases. 2001; 32: 1281-1289.
  18. Weinberger M. Respiratory infections and asthma: current treatment strategies. Drug Discovery Today. 2004; 9: 831-837.
  19. Lassmann B, et al. Community-acquired Pneumonia in Children in Lambarene, Gabon. Am. J. Trop. Med. Hyg. 2008; 79: 109-114.
  20. Feikin DR, et al. Viral and Bacterial Causes of Severe Acute Respiratory Illness Among Children Aged Less Than 5 Years in a High Malaria Prevalence Area of Western Kenya, 2007-2010. The Pediatric Infectious Disease Journal. 2013; 32: 14-19.
  21. Halsey ES, et al. Etiology and Incidence of Viral and Bacterial Acute Respiratory Illness among Older Children and Adults in Rural Western Kenya, 2007-2010. PLoS ONE. 2012; 7: e43656.
  22. Wertheim HFL, et al. Viral and atypical bacterial aetiologies of infection in hospitalised patients admitted with clinical suspicion of influenza in Thailand, Vietnam and Indonesia. Influenza and Other Respiratory Viruses. 2015; 9: 315-322.
  23. Bii CC, et al. Mycoplasma pneumoniae in children with pneumonia at Mbagathi District Hospital, Nairobi. East Afr Med J. 2002; 79: 317-322.
  24. Grassi T, et al. Chlamydophila pneumoniae, Mycoplasma pneumoniae, and influenza in children with respiratory infections in Alexandria, Egypt. The Journal of Infection in Developing Countries. 2014; 8.
  25. Ravelomanana L, et al. Prevalence of Mycoplasma pneumoniae Infection in Malagasy Children. The Pediatric Infectious Disease Journal. 2017; 36: 467- 471.
  26. Somer, A. Role of Mycoplasma pneumoniae and Chlamydia pneumoniae in Children with Community-Acquired Pneumonia in Istanbul, Turkey. Journal of Tropical Pediatrics. 2005; 52: 173-178.
  27. Zhou D, et al. High Prevalence of Mycoplasma pneumoniae and Chlamydia pneumoniae in Children with Acute Respiratory Infections from Lima, Peru. Plos One. 2017; 12: e0170787.
  28. Sanou MA, et al. Systematic Review of Articles on Etiologies of Acute Respiratory Infections in Children Aged Less Than Five Years in Sub- Saharan Africa, 2000-2015. EC Microbiology. 2016; 3: 556-571.
  29. Peng D, et al. Multipathogen infections in hospitalized children with acute respiratory infections. Virology Journal. 2009; 6: 155.

Citation: Sanou AM, Wandaogo SCM, Cissé A, Sagna T, Ouedraogo MS, Hübschen JM, et al. Low Prevalence of Mycoplasma pneumoniae and Chlamydia pneumoniae in Children Hospitalized for Acute Respiratory Infection in Burkina Faso. J Bacteriol Mycol. 2019; 6(5): 1116.