Shang W; Fan S; Short D; Cao X; Zhang H; Kasson MT; Chen Y; Hu X

Research Article

Austin Biol. 2016; 1(4): 1016.

Cochineal Scale (Porphyrophora ningxiana) Enhances Fusarium Wilt and Root Rot of Chinese Licorice Plant (Glycyrrhiza uralensis)

Shang W¹, Fan S², Short D³, Cao X¹, Zhang H⁴, Kasson MT³, Chen Y⁵ and Hu X¹*

¹Department of Plant Pathology, Northwest A&F University, China

²Department of Biochemistry and Molecular Biology, Northwest A&F University, China

³Department of Plant and Soil Sciences, West Virginia University, USA

⁴Department of Entomology, Northwest A&F University, China

⁵Beijing University of Agriculture, China

*Corresponding author: Xiaoping Hu, State Key Laboratory of Crop Stress Biology for Arid Areas, Department of Plant Pathology, College of Plant Protection, Northwest A&F University, Yangling 712100, China

Received: November 03, 2016; Accepted: November 29, 2016; Published: December 01, 2016

Abstract

Chinese licorice, the dried root of Glycyrrhiza uralensis, is used in traditional Chinese medicine. However, root rot of G. uralensis has gradually become a serious problem in licorice production in China. A 2012 survey of 22 commercial licorice fields revealed a root rot incidence of 36.5% infected plants. Infected plants were wilted with chlorotic foliage and discolored vasculature, and were significantly associated with a scale insect (Porphyrophora ningxiana) that parasitized plant roots (r = 0.9790, P < 0.001).Two previously characterized fungal isolates (FLR and G013) collected from infected licorice plant roots were used to inoculate licorice plant roots, which resulted in symptoms similar to those observed in field plants. Roots of licorice plant inoculated with FLR showed vascular discoloration, whereas those inoculated withG013 resulted in cortical root rot. Using phylogenetic analyses of the ribosomal Intergenic Spacer (IGS), ribosomal DNA and Internal Transcribed Spacers (ITS), translation elongation factor 1-alpha (EF1-a), and RNA polymerase II large subunit (RPB2), isolate FLR was identified as a novel sequence type within the Fusariumoxysporum Species Complex (FOSC), while isolate G013 was identified as a member of F. Solani Species Complex (FSSC) 11. Pathogenicity experiments revealed that isolate FLR can infect and cause disease in melon, soybean and potato; isolate G013 can infect and cause disease in pea, broad bean, soybean and potato. Additional experiments revealed that the incidence of root rot of licorice plants was significantly enhanced when cochineal scales presented in the soil.

Keywords: Glycyrrhiza uralensis; Fusarium oxysporum; Fusariumsolani; Fusarium wilt; Root rot; Porphyrophora ningxiana

Introduction

Glycyrrhiza uralensis Fisch, a leguminous perennial herb, is native to the Middle East and Central Asia including China, Afghanistan, Pakistan, Azerbaijan, Uzbekistan, Turkmenistan, Syria, and Turkey. Licorice, the dried root of G. uralensis, is used in two primary forms: root and extract. Records of licorice plant cultivation date back to the third century [1]. Licorice is a Chinese traditional medicine used for the treatment of various ailments including ulcers, sore throats, arthritis, and allergies [2-4]. It has also been a popular herbal medicine in Europe for centuries [2,5-12]. In addition, licorice is used as a food additive, a raw material in cosmetics and a flavoring agent for tobacco [13-15].

Licorice plant mainly grows in arid desert steppes and was historically harvested from wild resources, mainly limited to northwest and northeast areas of China, before domestic cultivation was established in the 1990s. Licorice plant cultivation has increased dramatically in recent years to fill shortages of wild licorice supplies. For example, licorice was produced on an estimated 125,408 hain 2011 [16]. Since 2002, there have been serious outbreaks of root rot and wilton cultivated G. uralensis plants in Ningxia, China, which severely reduced the yield and quality of licorice. Up to 30% mortality of cultivated licorice plants have occurred in fields and the disease complex is considered to be the most significant threat to commercial production of licorice in this area [17].

Previously, we reported the occurrence of two pathogens associated with Fusarium wilt of licorice plant [17], which were putatively identified as members of the F. oxysporum Species Complex (FOSC) and F. solani Species Complex (FSSC) based on sequence identity of the translation elongation factor 1-alpha (EF-1a) locus [18]. Subsequently, it was observed that 0the death of licorice plant was also associated with Porphyrophora ningxiana Yang (Hemiptera: Margarodidae), a subterranean scale insect commonly referred to as ‘ground pearls’ on account of the nymph stage being enclosed in a pearl-like cyst on the roots of plants. The ‘Cochineal Scale’ (CS), is a sessile plant parasite with one generation each year and four developmental stages: egg, 1^st nymph, 2^ndnymph (pearl scale), and adult (Figure 1). The CS mainly overwinters as eggs in egg oocysts. In soil, the nymphs can locate and attach to roots to extract sap, and produce the characteristic pearl-like cysts before the growing season commences. In August, adults emerge, mate, and then lay eggs in eggoocystsin soil between 2-6 cm underground [19].

Figure 1: Three morphologies of cochineal scale (Porphyrophora ningxiana Yang). A) 2nd nymph (pearl scale); B) female adult; C) male adult.

    
    
    Figure 1:  Three morphologies of cochineal scale (Porphyrophora ningxiana Yang). A) 2nd nymph (pearl scale); B) female adult; C) male adult.

The objectives of the current study were to 1) investigate the incidence and density of C Son roots of licorice plants 2) further characterize the Fusarium spp. associated with licorice wilt by performing multilocus phylogenetic analyses 3) assess the effect of licorice plant ground pearl on colonization of Fusarium infections 4) investigate the host range of the Fusarium spp. isolated from licorice plant root.

Materials and Methods

Field incidence of P. ningxiana and Fusarium spp. in cultivated G. uralensis

Symptomatic roots of licorice plants (G. uralensis) were sampled from 22cultivated fields at Ningxia and Inner Mongolia, China in July 2012. Infected plants exhibiting wilt with chlorotic foliage were targeted for destructive sampling. Symptomatic roots were excised for fungal isolation as well as for lab rearing of P. ningxiana (CS) when present. The percent of plants with CS and root discoloration associated with Fusarium infection, mean plant mortality rates, and population densities of insects were recorded.

Collection of P. ningxiana oocysts for laboratory experiments

In 2013, additional P. ningxiana oocysts were collected from cultivated licorice fields. Field soil containing oocysts(c.a. 5 oocysts per 100 g soil) was collected, brought back to laboratory, mixed with cow manure compost and sand (0.1:1:1, v/v/v), and fed and bred in 30-cm-dia. pots containing healthy G. uralensis seedlings. Plants were maintained in a greenhouse with the temperature of 20-30°C and a photoperiod of 10-14 h. Prior to planting, the cow manure compost and sand were autoclaved for 1 hour at 121°C. After c.a. 2 months in the greenhouse, the new oocysts produced in the potted licorice plants were then collected and used for inoculations.

Strain cultivation and inoculum preparation

Isolates from diseased roots were maintained on Potato Dextrose Agar (PDA) amended with 50 ng/ml streptomycin sulfate. Mycelia of FOSC isolate FLR and FSSC isolate G013 were grown in 300ml flasks with 100 ml Potato Dextrose Broth (PDB) at 25°C in darkness for 10days, washed with distilled water twice, and then used for genomic DNA extraction, respectively. Carnation Leaf Agar (CLA) plates were prepared for morphological studies using 15 g agar per 1000 ml distilled water and 4 pieces in 0.5 mm×0.5 mm carnation leaf and were used to induce sporodochium formation and macroconida [20]. The carnation leaves were dried in an oven with temperature of 45-55°C for 2 h and sterilized using Cobalt-60 radiation. Ten-dayold cultures growing on PDA at 25°C in darkness were used to make 5-mm-diameter fungal disks from colony margins using a puncher and transferred to CLA.

DNA manipulations

Genomic DNA was extracted from freeze-dried mycelia using a Hexadecyltrimethylammonium Bromide (CTAB) protocol as described in Kim et al. [21], and purified using a Wizard® Genomic DNA Purification Kit (Promega, Madison, WI). The Internal Transcribed Spacer (ITS) regions of the nuclear ribosomal DNA and translation elongation factor 1a (EF-1a) gene were amplified using PCR primers ITS1/ITS4 [22] and EF1-728F/EF1-986R [23], respectively (Table 1). The nuclear ribosomal DNA Intergenic Spacer Region (IGS) was amplified using PCR primers NL11/CNS1 [24] (Table 1). The RNA polymerase II gene (RPB2) was amplified using PCR primers RPB2-5F/RPB2-7cR, and RPB2-7cF/RPB2- 11aR [25] (Table 1). PCR amplifications were done with Platinum Taq DNA polymerase (Invitrogen Life Technologies, Carlsbad, CA, USA) in an Applied Biosystems 9700 thermo cycler (CA, USA) using the following program: 1 cycle of 2 min at 94°C; 35 cycles of 30 s at 94°C, 30 s at 55°C, and 2 min at 72°C; followed by 1 cycle of 10 min at 72oC and a 4oC forever. All PCR products were separated in a 1.5% agarose gel, stained with ethidium bromide, and photographed over a UV transilluminator. PCR products were purified using the Agarose Gel Extraction Kit (Roche Inc., Germany), cloned into pDM18-T vector (TaKaRa, Japan) and transformed into Escherichia coli JM109 using an electroporation method [26]. After cloning, 10 positive colonies from each transformation were randomly selected, and each colony was recovered in a LB liquid medium supplemented with 100 μg.ml-1 ampicillin following overnight incubation at 37°C. The recombinant plasmid was extracted using Plasmid Miniprep Kit (Bioniga, USA). The confirmation of positive colonies was confirmed through restriction digestion with KpnI and Hind III. The plasmid was sequenced by Life technologies (Thermo Fisher Scientific, USA).

Table 1: Primers used in this study.




  
    Primer name 
    Primer sequence5'-3' 
    Loci amplified 
    Annealing temperature (^oC) 
    Primer sequence origin 
  
  
    ITS1
    TCCGTAGGTGAACCTGCGG
    ITS
    55
    White, 1990
  
  
    ITS4
    TCCTCCGCTTATTGATATGC
    
    
    
  
  
    EF1-728F
    CATCGAGAAGTTCGAGAAGG
    EF-1a
    55
    Carbone et al., 1999
  
  
    EF1-968R
    TACTTGAAGGAACCCTTACC
    
    
    
  
  
    NL11
    CTGAACGCCTCTAAGTCAG
    IGS
    55
    O’Donnell et al., 2009
  
  
    CNS1
    GAGACAAGCATATGACTACTG
    
    
    
  
  
    RPB2-5F
    GA(T/C)GA(T/C)(A/C)G(T/A)GATCA(T/C)TT(T/C)GG
    RPB2
    55
    Liu et al., 1999
  
  
    RPB2-7cR
    CCCAT(A/G)GCTTG(T/C)TT(A/G)CCCAT
    
    
    
  
  
    RPB2-7cF
    ATGGG(T/C)AA(A/G)CAAGC(T/C)ATGGG
    RPB2
    55
    Liu et al., 1999
  
  
    RPB2-11aR
    GC(A/G)TGGATCTTRTC(A/G)TC(C/G)ACC
    
    
    
  
  
    M13F(-47)
    CGCCAGGGTTTTCCCAGTCACGAC
    -
    55
    pMD18-T, TaKaRa
  
  
    M13R(-48)
    AGCGGATAACAATTTCACACAGGA
    
    
    
  
  
    FLR.W1F
    TGGCGGATCTGACACTGTCG
    -
    51
    Primer walking sequence
  
  
    FLR.W1R
    CACGCCAGAACTGCTTCGTG
    
    
    
  
  
    G013.W1F
    CCACCAATGCCGCCATTCTT
    -
    49
    Primer walking sequence
  
  
    G013.W1R
    GCATCCTCAAGGCACCAACA



Table 1:  Primers used in this study.

Phylogenetic analysis

Isolates FLR and G013 were previously identified as “F. oxysporum” and “F. solani”, respectively, based on EF-1a sequences. In this study, additional loci were sequenced and analyzed using existing Fusarium data sets for phylogenetic species recognition based on genealogical concordance of multilocus DNA sequence data [24,27]. This approach has previously been used to identify environmental isolates of Fusarium spp. to species and sequence type [28]. Two nucleotide sequence data sets, one for FOSC and one for FSSC were constructed from data in NCBI GenBank; additional sequence data was kindly provided by Dr Kerry O’Donnell (USDAARS). Sequence data for EF-1a and IGS from isolate FLR were aligned with the data set of known FOSC diversity using Molecular Evolutionary Genetics Analysis (MEGA) 6.06 [29]. Similarly, sequence data for EF-1a, ITS and RPB2 were aligned with the data set of known FSSC diversity. Maximum Parsimony (MP) and Maximum Likelihood (ML) analyses were performed on both data sets; insertion deletion polymorphisms were not coded because MEGA does not allow for numerical characters. MP phylogenies were constructed using a sub tree-pruning-regrafting search method with 10 initial trees, a search level of 1, and 100 maximum trees to retain; 100 bootstrap replications were performed. ML phylogenies were constructed using a Tamura-Nei substitution model, uniform rates among sites, a heuristic method of nearest-neighbor-interchange, an initial neighbor joining tree, and a very strong branch swap filter; 100 bootstrap replications were performed. After the aforementioned phylogenetic analyses, sequence data for isolates FLR and G013 were visually compared to the most similar FOSC and FSSC sequence types in respective phylogenetic trees, in order to verify that they contained unique characters that differentiated them from other sequence types.

Effect of root feeding by cochineal scale on Fusarium infection

To determine the relationships between licorice plants infected by Fusarium spp. And CS colonization, the following four treatments were initiated: for treatment I: licorice seedlings were planted in pots of 30-cm-diameter (4 seedlings each) containing cow dung compost and sand (1:1, v/v) as a non-inoculated control; for treatment II: five petri dishes (9 cm in diameter) of 3-days PDA cultures of FLR and G013 were cut into small pieces using a sterilized scalpel and mixed into cow dung compost and sand of each pot. The oocysts of CS (ca. 20) were buried near the root of licorice seedlings at an approximate depth of 2-10 cm; for treatment III: the same as in treatment II except without oocysts of CS; for treatment IV: same as treatment II except that oocysts of CS were excluded and roots were wounded with a sterilized needle 2-10 cm below the soil surface. Each treatment contained two replicates for a total of eight pots (ca. 30 seedlings) across all treatments. All seedlings were kept in a greenhouse with the temperature of 20-30°C and a photoperiod of 10-14 h.

Host range of Fusarium isolates

Inoculations with FOSC isolate FLR and FSSC isolate G013 were conducted in the greenhouse on 1-month-old potted G. uralensis seedlings (12 plants per treatment) to confirm pathogenicity. These served as a positive control for the other species tested. One root per seedling was wounded about 2-10 cm below the soil surface using a sterilized needle. Fungal isolates were started on PDA and incubated in darkness at 22°C for 3 days. Five 5-mm-diameter fungal disks from colony margins were taken and firmly placed on the wounded root of each plant and fixed with aluminum foil. Seedlings treated with sterile PDA disks were used as controls. Root disease was assessed at two months after inoculation. To complete Koch’s postulates, the inoculated isolates were re-isolated and confirmed as the pathogen inoculated morphologically.

To determine whether Fusarium spp. isolates from licorice plant root caused disease on other members of the Fabaceae, other plants including alfalfa (Medicago sativa L.), kidney bean (Phaseolus vulgaris L.), pea (Pisum sativum L.), broad bean (Viciafaba L.), cowpea (Vigna unguiculata (L.) Walp.), soybean (Glycine max (L.) Merr.). Melon (Cucumismelo L.), cucumber (Cucumis sativus L.), eggplant (Solanum melongena L.), potato (Solanum tuberosum L.), pepper (Capsicum frutescens L.), tomato (Solanum lycopersicum L.), wheat (Triticum aestivum L.), corn (Zea mays L.) and cotton (Gossypium hirsutum L.) were used in the host range experiments. Commercial seeds were purchased from Xi’an Gude Seed Company, China. Healthy seedlings of G. uralensis supplied by Gancao Experimental Station of Yanchi County, China were included as positive controls. The extent of root and crown discoloration in inoculated and control plants was rated on a 0-to-5 scale, where 0 = no vascular discoloration; 1 = 1 to 25% of the vascular tissue exhibiting discoloration; 2 = 26 to 50%, 3 = 51 to 75%, and 4 = 76 to 100% discoloration; and 5 = 100% discoloration.

The disease scale values of each plant in each treatment were scored and averaged.

Data analysis

Pearson correlation analysis was conducted to determine the relationship between diseased licorice plants and P. ningxianainhabited roots. All data analysis was conducted using the software R (version 2.11.1). The sequences of Internal Transcribed Spacer (ITS), intergenic spacer region (IGS), translation elongation factor 1a (EF-1a), and the RNA polymerase II gene (RPB2) gene were used to construct the phylogenetic tree using Molecular Evolutionary Genetics Analysis (MEGA) 6.06.

Results

Field incidence of Fusarium spp. and P. ningxiana in cultivated G. uralensis

Typical symptoms of Fusarium root rot of G. uralensis were observed in Yanchi county, Ningxia, China. Initial symptoms included wilting and chlorosis of foliage as well as obvious root rot as a severe brown discoloration of vascular tissue (Figure 2A,B). White mycelia were visible on diseased root tissue and roots were eventually decomposed.

Figure 2: Symptoms of Glycyrrhiza uralensis root rot caused by Fusarium spp. A) healthy plants in a field; B) diseased plants in a field; C) root colonized by cochineal scales; D) cochineal scales; E) cross-section of a healthy root; F) cross-section of a diseased plant colonized by cochineal scales; G) vascular discoloration of root produced by isolate FLR one months after inoculation; H) cortex tissue was destroyed, and eventually all root tissue by isolate G013 one months after inoculation.

    
    
    Figure 2:  Symptoms of Glycyrrhiza uralensis root rot caused by Fusarium spp. A) healthy plants in a field; B) diseased plants in a field; C) root colonized by cochineal
scales; D) cochineal scales; E) cross-section of a healthy root; F) cross-section of a diseased plant colonized by cochineal scales; G) vascular discoloration of root
produced by isolate FLR one months after inoculation; H) cortex tissue was destroyed, and eventually all root tissue by isolate G013 one months after inoculation.

The association of root discoloration with root rot symptoms varied from 0 to 92% (mean = 36.5%, n=479) (Table 2). The cooccurrence of diseased roots and P. ningxiana (Figure 2C,D) varied from 0.0 to 84.0% (mean = 29.7%, n = 479) (Table 2). The association of plant mortality with diseased roots varied from 0 to 50% across all sampled locations (mean = 11%, n = 479) (Table 2). Diseased licorice plants (root discoloration rate) had a significant relationship with P. ningxiana-inhabited roots (plant rate with insect) (r=0.9790, P<0.001, n = 11).

Table 2: Occurrence of Porphyrophora sophorae and Fusarium spp. on Glycyrrhiza uralensis plants in Ningxia and Inner Mongolia, China.




      
      
      
      
      
      
      
      
      
      
      
      
      
  
    Site 
    Latitude and longitude 
    Altitude (m) 
    Number of plant 
    Plant with insect rate (%) 
    Root discoloration rate (%) 
    Plant death rate (%) 
    Population density of insect 
    Growth type 
  
   
  
    Zuojiwan, Yanchi, Ningxia
    N37°59'317”, E107°21'962”
    1334
    50
    84
    92
    50
    5.8
    C
  
    Wanglejin, Yanchi, Ningxia
    N37°53'509”, E106°59'845”
    1416
    46
    0
    0
    0
    0
    W
  
    Gaoshawo, Yanchi, Ningxia
    N37°59'270”, E107°02'461”
    1413
    40
    12.5
    37.5
    5
    2.2
    W
  
    Liubazhuang, Yanchi, Ningxia
    N37°50'498”, E107°18'120”
    1433
    16
    18.8
    25
    0
    4.1
    W
  
    Habahu, Yanchi, Ningxia
    N37°42'580”, E107°03'407”
    1453
    50
    0
    0
    0
    0
    W
  
    Sunjialoua, Yanchi, Ningxia
    N37°51'841”, E107°03'078”
    1476
    30
    73.3
    83.3
    40
    16.1
    C
  
    Sunjialoub, Yanchi, Ningxia
    N37°52'843”, E107°03'008”
    1476
    48
    27.1
    31.3
    0
    9
    W
  
    Chengxitan, Yanchi, Ningxia
    N37°47'818”, E107°17'327”
    1429
    66
    0
    0
    0
    0
    C
  
    Shabianzi, Yanchi, Ningxia
    N37°53'549”, E107°31'97”
    1322
    50
    84
    90
    8
    41.7
    N
  
    Aolezhaoqi, Inner Mongolia
    N38°10'027”, E107°27'702”
    1319
    33
    27.3
    42.4
    18.2
    22.3
    W
  
    Sanduandi, Inner Mongolia
    N38°08'758”, E107°25'697”
    1314
    50
    0
    0
    0
    0
    W
  
    Average
    -
    -
    -
    29.7
    36.5
    11
    9.2
    -
  
    C:    artificially cultivated Glycyrrhiza    uralensis plants; W: wild Glycyrrhiza    uralensis plants; N: Glycyrrhiza    uralensis plants in nursery.



Table 2:  Occurrence of Porphyrophora sophorae and Fusarium spp. on Glycyrrhiza uralensis plants in Ningxia and Inner Mongolia, China.

Pathogen isolation and identification

Isolates from diseased roots were grown on PDA amended with streptomycin sulfate. Isolates (n = 80) previously recovered from symptomatic roots (n= 105) [17] were single-spored to obtain pure cultures. The most frequently isolated fungal morphotypes were identified putatively as F. oxysporum (30.8%) and F. solani (61.5%) based on morphological characteristics including macrocondia and monophialides [30]. Roots of licorice plant inoculated with FLR showed vascular discoloration (Figure 2E,F,G). Roots inoculated with G013 showed cortical root rot (Figure 2H). Fusaria with typical morphology were re-isolated from symptomatic roots. Control plants inoculated with sterile PDA disks remained asymptomatic two months post inoculation and no pathogen was isolated.

Morphological features of G013 were as follows: top of colonies on PDA were white to light yellow-green, with purple-red pigment in the center (Figure 3A); reverse of colonies were yellow to light yellow (Figure 3B). Fusiform macroconidia of G013 were 20.0-50.0×4.5- 7.5μm, rounded at both ends, 2-5 septa and with obvious podocytes (Figure 3C). Kidney-shaped microconidia of G013 were7.5- 16.0×2.5-5.3μm, formed on long, septate and occasionally branched conidiophores (Figure 3D,E). Colonies of FLR on PDA were white, with a purple pigment in center (Figure 4A); reverse of colonies were yellow to light yellow (Figure 4B). Conidiophores were 7.5-22.5×2.5- 5.0μm, solitary, unbranched, and slightly smaller near the point of sporulation (Figure 4C). Microconidia of FLR were 5.0-15.0×2.5- 7.5μm, ovoid, aseptate or occasionally single septate, born on lateral, bottle-shaped conidiophores (Figure 4D). Macroconidia of FLR were 15.0-32.5×5.0-10.0μm, sickle-shaped, and usually 3 to 5 septa (Figure 4E). Chlamydospores were spherical, borne on or between the apical short branches, either alone or in chains (Figure 4F).

Figure 3: Morphology of isolate G013. A) the front of the colony after being cultivated on Potato Dextrose Agar (PDA) plate in darkness for 2 days; B) the back of the colony after being cultivated on PDA plate in darkness for 2 days; C) microconidia; D) macroconidia; E) conidiophores.

    
    
    Figure 3:  Morphology of isolate G013. A) the front of the colony after being cultivated on Potato Dextrose Agar (PDA) plate in darkness for 2 days; B) the back of
the colony after being cultivated on PDA plate in darkness for 2 days; C) microconidia; D) macroconidia; E) conidiophores.

Figure 4: Morphology of isolate FLR. A) the front of the colony after being cultivated on Potato Dextrose Agar (PDA) plate in darkness for 2 days; B) the back of the colony after being cultivated on PDA plate in darkness for 2 days; C) conidiophores; D) microconidia; E) macroconidia; F) chlamydospore.

    
    
    Figure 4:  Morphology of isolate FLR. A) the front of the colony after being cultivated on Potato Dextrose Agar (PDA) plate in darkness for 2 days; B) the back of
the colony after being cultivated on PDA plate in darkness for 2 days; C) conidiophores; D) microconidia; E) macroconidia; F) chlamydospore.

Table 3: The host range of the pathogenic isolate G013 and FLR.




  
    Taxonomic statue 
    Inoculated plant 
    DS 
  
  
    Latin name
    Cultivar
    Common name
    G013
    FLR
  
  
    Leguminosae
    Medicago sativa L.
    Muxuwang 
    Alfalfa 
    0
    0
  
  
    
    Phaseolus vulgaris L.
    Fengshou 1
    Kidneybean
    0
    0
  
  
    
    Pisum sativum L.
    Wangnong 604
    Pea
    1.1
    0
  
  
    
    Vicia faba L.
    Qinghai 3
    Broad bean
    0.8
    0
  
  
    
    Vigna unguiculata (L.) Walp.
    Zaoyu 80
    Cowpea
    0
    0
  
  
    Cucurbitaceae
    Cucumismelo L.
    Zaomi 1
    Melon
    0
    2.8
  
  
    
    Cucumissativus L.
    Jinyou 1
    Cucumber 
    0
    0
  
  
    Papilionaceae
    Glycine max (L.) Merr.
    Huajiang 4
    Soybean 
    0.9
    0.8
  
  
    Solanaceae
    Solanummelongena L.
    Liuyeqie
    Eggplant 
    0
    0
  
  
    
    Solanum tuberosum L.
    Zhuangshu 4
    Potato 
    0.8
    3.3
  
  
    
    Capsicum frutescens L.
    8819
    Pepper
    0
    0
  
  
    
    Solanum lycopersicum L.
    Zhongza 109
    Tomato
    0
    0
  
  
    Gramineae
    Triticumaestivum L.
    Xiaoyan 22
    Wheat 
    0
    0
  
  
    
    Zea mays L.
    Shandan 609
    Corn
    0
    0
  
  
    Malvaceae
    Gossypium spp.
    Jimian    11 
    Cotton 
    0
    0
  
  
    DS = Disease severity was assessed based on the extent of    root and crown discoloration on a 0-to-5 scale, where 0 = no vascular    discoloration; 1 = 1 to 25% of the vascular tissue exhibiting discoloration;    2 = 26 to 50%, 3 = 51 to 75%, and 4 = 76 to 100% discoloration; and 5 = 100%    discoloration.



Table 3:  The host range of the pathogenic isolate G013 and FLR.

Phylogenetic species identification based on genealogical concordance of multilocus DNA sequence data clearly identified isolate G013 as a member of FSSC 11, also known as F. solanif. sp. Pisi and mating population VI [31]. Several unique Single Nucleotide Polymorphisms (SNPs) and insertion deletion polymorphisms (indels) within the multilocus data set were unique, revealing that G013was a novel sequence type within FSSC 11. The FOSC isolate FLR appeared as a distinct sequence type within FOSC; while this isolate shared an identical EF-1a allele and nearly identical IGS allele with NRRL 32328 (ST 197), that contained a unique 79-bp insertion polymorphism within the IGS (Figure 5).

Figure 5: Phylogenetic tree of the Fusariumsolani Species Complex (FSSC) constructed using Maximum Likelihood. Isolate G013 is conspecific with FSSC 11, F. solani f. sp. pisi, (Mating population VI and MPVI). Alignment included 3441 characters.

    
    
    Figure 5:  Phylogenetic tree of the Fusariumsolani Species Complex (FSSC)
constructed using Maximum Likelihood. Isolate G013 is conspecific with
FSSC 11, F. solani f. sp. pisi, (Mating population VI and MPVI). Alignment
included 3441 characters.

Effect of cochineal scale colonization on Fusarium infection

Percent disease incidence in G. uralensis seedlings in treatment I, II, III, and IV was 0.0, 67.7, 10.0, and 86.5, respectively. Plants wounded and inoculated with FLR and G013 (treatment IV) showed the highest disease incidence, which has no significant difference (P>0.01) with treatment II; however, both treatments II and IV were significantly different (P<0.01) from treatment III and the control (treatment I) (Figure 6), suggesting that the incidence of root rot of licorice seedlings was greatly enhanced by the co-occurrence of CS in infested soil.

Download PDF

Citation: Shang W, Fan S, Short D, Cao X, Zhang H, Kasson MT, et al. Cochineal Scale (Porphyrophora ningxiana) Enhances Fusarium Wilt and Root Rot of Chinese Licorice Plant (Glycyrrhiza uralensis). Austin Biol. 2016; 1(4): 1016.

Instruction for Authors

Submit Your Article