Implication of miRNAs in the Pathogenesis of Gallbladder Cancer

  

    
Micro-RNA 
    
Up/Down Regulation 
    
Chromosomal location
    
Mature miRNAs sequences 
    
Number validated targets 
    
Potential target in GBC 
    
Reference 
  
  

    
hsa-miR-1
    
Down
    
20q13.33
      
18q11.2
    
5' uggaauguaaagaaguauguau3' 
    
118
    
VEGF-A
      
AXL 
    
[36] 
  
  

    
hsa-miR-145-5p
    
Down
    
5q32
    
5' guccaguuuucccaggaaucccu3' 
    
19
    
Unknown 
    
[36] 
  
  

    
hsa-miR-135a
    
Down
    
3p21.1
    
5' uauggcuuuuuauuccuauguga 3' 
    
3
    
VLDLR
    
[37]
  
  

    
hsa-miR-26a
    
Down
    
3p22.2
    
5' uucaaguaauccaggauaggcu 3' 
    
6
    
HMGA2
    
[43]
  
  

    
hsa-miR-34a
    
Down
    
1p36.22
    
5' uggcagugucuuagcugguugu 3' 
    
24
    
PNUTS
    
[45] 
  
  

    
hsa-miR-335
    
Down
    
7q32.2
    
5' ucaagagcaauaacgaaaaaugu 3'
    
3
    
Unknown 
    
[48] 
  
  

    
hsa-miR-130a
    
Down 
    
11q12.1 
    
5' cagugcaauguuaaaagggcau 3' 
    
7
    
Unknown 
    
[54] 
  
  

    
hsa-miR-218-5p
    
Down
    
4p15.31
      
5q34
    
5' uugugcuugaucuaaccaugu 3´
    
4
    
BMI-1 
    
[57] 
  
  

    
hsa-miR-155
    
Up
    
21q21.3
    
5' uuaaugcuaaucgugauaggggu 3' 
    
26
    
Unknown 
    
[63] 
  
  

    
hsa-miR-20a
    
Up
    
13q31.3
    
5' uaaagugcuuauagugcagguag 3'
    
2
    
SMAD-7
    
[68] 
  
  

    
hsa-miR-182
    
Up 
    
7q32.2 
    
5' uuuggcaaugguagaacucacacu 3' 
    
4
    
CADM1
    
[76] 
  
  

    
Chromosomal    Location, sequence and number validated targets were    obtained from https://mirecords.biolead.org/index.php and https://www.ncbi.nlm.nih.gov/ 
      
Abbreviations:    GBC: Gallbladder Cancer; VEGF-A: Vascular Endothelial Growth Factor A; AXL: AXL receptor tyrosine kinase; VLDLR: Very    Low Density Lipoprotein Receptor; HMGA2: High Mobility Group AT-hook 2;    PNUTS: Phosphatase 1 Nuclear Targeting Subunit; SMAD7: Mothers against    Decapentaplegic Homolog 7; CADM1: d Cell adhesion molecule1. 
      
 
  

Table 1:  Characteristics of tumor-suppressor and oncogenic miRNAs in gallbladder cancer.

Tumor-Suppressor miRNAs in GBC

miR-1 and miR-145

miR-1 and miR-145 have been extensively studied as potential tumor suppressors in different human tumors such as colorectal cancer [29,30], prostate cancer [31], thyroid carcinoma [32], squamous cell carcinoma of the jaw sine [33], B-cell malignancies [34] and breast cancer [35]. Recently, we used the significance analysis of microarrays (SAM) algorithm to identify a set of 36 miRNAs consistently down regulated in GBC compared to normal gallbladder mucosa. The qRTPCR analysis confirmed this reduced expression of miR-1, miR-133 and miR-145 (P < 0.05) in tumors and GBC cell lines compared to normal gallbladder tissues [36]. The ectopic expression of miR-1 and miR-145 in NOZ cell lines of GBC significantly inhibited cell viability and colony formation (P < 0.01) and only miR-1 reduced gene expression of known oncogenes such as the vascular endothelial growth factor A (VEGF-A) and AXL receptor tyrosine kinase (AXL), suggesting that miR-1 and miR-145 act as tumor suppressor miRNAs in GBC [36]. Interestingly, in a study driven in Chinese population, 23 down regulated miRNAs were identified based on the miRNA chip results obtained from four paired GBC and paracancerous tissues. The miR-1 expression was significantly lower in the GBC tissues compared with the expression of other down regulated miRNAs (P < 0.001 and fold change of -170) [37]. Several studies indicate that miR-1 regulates a wide set of genes such as MET, FOXP1, HDAC4 and PIM1 in lung cancer [38], LIM LASP1 and SRSF9 in bladder cancer [39,40], CCND2, CXCR4 and CXCL12 in thyroid cancer [32]; PNP and TAGLN2 in maxillary sinus squamous cell carcinoma [33], PTMA in nasopharyngeal carcinoma [41]; and FN1 in laryngeal squamous carcinoma [42].

miR-135a-5p and miR-26a

miRNA-135a-5p (miR-135a) and miR-26a have been found as significantly down regulated in GBC tissues from a Shanghai population cohort compared with paracancerous tissues [37,43]. Further, ectopic expression of miR-135a and miR-26 inhibited the proliferation of GBC cells in vitro and in vivo by directly targeting the very low density lipoprotein receptor (VLDLR) and the high mobility group AT-hook 2 (HMGA2), respectively [37,43]. The expression of these miRNAs was also correlated with the histologic grade in patients with GBC [37,43]. In addition, the miR-135a-5p–VLDLR axis exerts its function through the activation of p38/MAPK pathway, being implicated in many physiological and carcinogenic processes, such as cell proliferation, cell differentiation, cell death, cell migration, and invasion [37,44].

miR-34a

The miR-34a expression has been found significantly lower in gallbladder tumor tissues than in peritumoral tissues. Further, miR- 34a is involved in a decreased colony formation in vitro, a decrease in telomere length, and in the inhibition of tumor growth in vivo, which was associated with the down regulation of phosphatase 1 nuclear targeting subunit (PNUTS) [45]. As known, the telomere biology plays a critical and complex role in the initiation and progression of cancer [46]. Moreover, survival information of 77 patients with GBC revealed that patients with lower miR-34a expression survived significantly less than patients with a higher miR-34a expression (P < 0.001). Multivariate survival analysis using cox regression model revealed that miR-34a expression was positively correlated with overall survival in GBC patients [45]. In fact, miR-34a is currently one of the most characterized tumor suppressor miRNAs in a variety of tumors and antagonizes vital processes of tumor aggressiveness such as cell viability, cancer stemness, metastasis and chemoresistance [47].

miR-335

The reduced expression of miR-335 is associated with aggressive clinicopathologic features of GBC, specifically with high histologic grade, advanced clinical stage and positive lymph node metastasis [48]. Furthermore, a reduced expression of miR-335 in GBC patients is associated with poor prognosis and determines an independent prognostic influence factor on overall survival [48]. miR-335 has been identified as a metastasis-suppressor miRNA in cancers and its low expression has a close correlation with cancer development [49-52]. In contrast, over expression of miR-335 may also have an important role in the development of pediatric acute leukemia [53], confirming the dual functions of miRNAs due to tissue specificity of these molecules.

miR-130a and miR-218-5p

miR-130a inhibits proliferation in GBC cell lines and its expression is regulated by HOTAIR’s [54], a long non-coding RNAs (lncRNA) with oncogenic properties [55]. lncRNA HOTAIR is involved in specific chromatin remodeling and is a strong predictor for metastasis in some cancers such as breast cancer [56]. A recent publication has shown that the Colon Cancer-Associated Transcript-1 (CCAT1), a 2628-bp lncRNA promotes GBC development via negative modulation of miR-218-5p. In vitro assays showed that miR-218-5p module gene expression of polycomb group gene BMI-1 [57]. miR-130a and miR-218-5p have been found down regulated in several carcinomas and exhibits tumor-suppressive activity [58-61]. However, miR-130 has a pro-angiogenic effect because that down regulates antiangiogenic homeobox proteins GAX (growth arrest homeobox) and HOXA5 [62].

Oncogenic miRNAs in GBC

miR-155

The expression of miR-155 has been found significantly higher in the GBC tissues compared with normal gallbladder. Interestingly, the miR-155 expression is not up regulated in gallbladders with pancreaticobiliary maljunction. A high miR-155 expression was significantly associated with the presence of lymph node metastasis, vessel invasion and poor prognosis. In vitro assays showed that aberrant expression of miR-155 significantly enhanced GBC cell proliferation and invasion [63]. Previous reports have suggested that miR-155 is an oncogenic miRNA, which is also over expressed in other human malignancies, including pancreas, colon, glioma, prostate cancers [64-67].

miR-20a

miR-20a is up regulated in GBC and plays a potential role in promoting both cell proliferation and metastasis in vitro and in vivo through a direct binding to the SMAD7 mRNA, a potential inhibitor of TGF-β1 signaling pathway, suggesting that TGF-β1/miR-20a/ SMAD7 axis plays an important role in the progression of GBC [68]. Patients with a higher expression of miR-20a exhibited worse overall survival [68]. Moreover miR-20a increase the length and thickness of F-ACTIN microfilaments, a stress fiber regulating cell motility and polarization associated a metastatic property [68].

miR-20a is encoded by the miR-17-92 cluster (miR-17-5p, miR- 17-3p, miR-18a, miR-19a, miR-19b and miR-20a) [62], a miRNA polycistron also known as oncomir-1, which is among the most potent oncogenic miRNA genes [69]. For example, in cholangiocarcinoma (CCA), an epithelial cancer within the biliary tree [70], was observed that the over expression of miR-17-92 cluster increase tumor cell proliferation in vitro and in vivo [71]. Many studies have found that miR-20a is over expressed in the lung cancer [72], glioma [73] and prostate cancer [74], influencing the tumor phenotype in these malignancies. However, other reports have shown that miR-20a is down regulated in cutaneous squamous cell carcinoma and is involved in tumor inhibition [75]. These results suggest that miR-20a could play a role both as oncogene and tumor-suppressor miRNA, similar to miR-335 and miR-130, above-mentioned.

miR-182

miR-182 levels were also significantly up regulated in metastatic GBC patients compared with normal gallbladder tissues, promoting cell migration and invasion by targeting cell adhesion molecule 1 (CADM1) [76]. This over expression of miR-182 in GBC cells may be induced by transforming growth factor beta (TGF- β) [76]. Recent publications have reported that miR-182 is deregulated in stomach cancer [77], ovarian cancer [78], breast cancer [79], pancreatic cancer [80] and colorectal carcinoma [81], being involved in carcinogenic processes such as alterations in cell cycle, proliferation, invasion, metastasis and epithelial-mesenchymal transition [77- 84]. Furthermore, circulating miR-182 has been detected in clinical specimens such as plasma and serum in pancreatic cancer [80], breast cancer [85] and lung cancer patients [86] with a high specificity.

Other miRNAs with a potential oncogenic role, whose levels are significantly higher in GBC compared to normal tissues, are hsa-miR- 196a, hsa-miR-205, hsa-miR-196b and hsa-miR-1290 (P<0, 05) [37]. In addition, our research group have shown that miR-92b*, miR-923, miR-149*, miR-513a-5p and miR-765 are over expressed in GBC (unpublished data).

Discussion

The gallbladder cancer is the most common malignancy within biliary tract with remarkable incidence variations around the world [23,87]. The GBC cases are diagnosed in advanced stages, resulting a very poor prognosis [88]. Therefore, it is necessary identify and validate novel markers and therapeutic targets in order to improve the diagnosis, prognosis or treatment for advanced GBC patients. miRNAs are a class of small, single-stranded, non-coding RNA molecules which can act as oncogenes or tumor suppressor genes in human cancers [43,89]. Different studies have reported that several miRNAs are significantly deregulated in GBC, most of them showing a decreased expression in GBC compared to normal gallbladder tissues (miR-1, miR-145, miR-135a-5p, miR-26a, miR-34a, miR-335, miR-130a and miR-218-5p) and others showing increased expression in neoplastic tissue compared to normal gallbladder tissues (miR- 155, miR-20a and miR-182). Interestingly, some of these miRNAs as miR-26 [90], miR-34a [91] and miR-155 [92] also exhibited aberrant expression in CCA. Furthermore, miR-21 that was significantly up regulated in BK5.erbB2 mice model [26] as well as CCA [93], showed a sensitivity of 95% and a specificity of 100%in distinguishing between CCA and normal tissues [93].

The miRNA expression has been correlated with pathologic parameters, according to TNM staging system for GBC (American Joint Committee on Cancer, AJCC, and 7th edition) [94]. The reduced expression of miR-135-5p, miR-26a and miR-335 showed a significant association with TNM stage (stage I + II vs. stage III + IV) [37, 43, 48]. In addition, the reduced expression of miR-335 is associated with positive lymph node metastasis [48]. Otherwise, oncogenic miRNAs (which are over expressed in GBC tissues), were associated with cell invasion in mouse models (miR-182 and miR- 20a) [68,76] and enhanced the proliferation and invasion in GBC cell lines (miR-155) [63]. In terms of the evaluation of survival, patients with lower miR-34a and miR-335 expression had poorer survival than patients with a higher expression of these miRNAs, and both were independent prognostic factors of GBC outcomes [45,48]. In contrast, GBC patients with higher miR-155 and miR-20a expression showed a significantly poorer survival [63,68]. However the multivariate survival analysis revealed that only miR-20a was an independent prognostic factor [68]. Different in vitro studies demonstrate that ectopic expression of some miRNAs showed a significantly decreased colony formation (miR-1, miR-145 and miR34a) [36,45], an inhibition of cell viability (miR-1 and miR-145) [36], and inhibition of the GBC cell proliferation (miR-135, miR- 26 and miR-130a) [37,43,54]. In contrast, inhibitors against miR- 155, miR-20a and miR-182 decreased in vitro cell proliferation and invasion [63,68,76], suggesting that these miRNAs play a regulating role in the tumorigenesis and progression of GBC.

The scientific evidence indicates that deregulation of miRNA expression could be explained by several mechanisms. Around 50% of genes encoding miRNAs are located at fragile sites of genome and in sites called “cancer associated genomic regions” (CAGRs), which can present Loss of Heterozygosity (LOH), breakpoint zones, and amplification, deletion or mutation regions [95-97]. For example, miR-26a gene is located in 3p23, which is a fragile chromosomal region associated with various human cancers [98]. Although the most of miRNAs are in intergenic regions, several of them are located in intronic regions of known genes and could be co-transcribed, or are located in clusters of miRNAs, transcribed individually or in group from polycistronic sequences (e.g. miR-17-92 cluster, where miR-20a is encoded) [99,100]. A lower percentage of miRNAs are expressed independently with their own promoter regions [101]. Therefore, as the majority of genes, miRNA transcription is regulated by many transcription factors (TP53, MYC, and RAS) in a tissue specific manner [89].

Aberrant DNA methylation in promoter regions also regulate to miRNA gene expression in human cancer [102,103], silencing especially tumor suppressor miRNAs (miR-1 [31,104,105], miR-145 [106,107], miR-26 [108], miR-34a [109-112] and miR-335 [49,113]). In addition, the epigenetic regulation has been demonstrated experimentally in oncogenic miRNAs, such as miR-155 in cell lines of multiple myeloma [114] and miR-17-92 cluster in idiopathic pulmonary fibrosis [115]. Most promoter regions are closely related to CpG islands, however, silencing by DNA methylation does not always require the vicinity of CpG islands, such as the case of miR-199 which is methylated distal to the promoter (without a CpG island) in a cell line of testicular cancer [116]. Other important factor that can also affect the expression and function of miRNAs is related to an inadequate biogenesis, caused by a defect in key enzymes involved in this process (Drosha, Dicer and Exportin 5). The inactivation of Drosha or Dicer results in a significant reduction of miRNAs leading to an aberrant expression in several cancers [117-121]. Dicer and Drosha expression is significantly lower in gallbladder adenocarcinoma compared to non-dysplastic gallbladder epithelia and was significantly associated with lymph node metastasis and decreased overall survival of patients [28], suggesting that aberrant levels of these enzymes may be involved in the deregulation of miRNA expression and consequently in the pathogenesis of GBC. The inactivation of XPO5 also result in the nuclear retention of miRNA precursors [89] but there are not studies about XPO5 expression in GBC.

Conclusion

The multiple genetic alterations found in cancer are associated with numerous structural and functional changes. Although most of the neoplastic processes follow a common pattern, there are specific genes that are directly related to the affected tissue. These alterations are usually acquired during a prolonged time and are result of increased genomic instability which leads to up regulation of oncogenes and suppression of tumor suppressor genes. Thus, during the onset and neoplastic progression, malignant cells become independent from tissue physiological control through gain certain characteristics as own transforming growth signals, evasion of apoptosis, angiogenesis development, unlimited replicative potential, invasiveness (metastasis), the escape of immune response and resistance to certain treatments [122]. Descriptive studies indicate that gallbladder carcinogenesis is a multifactorial process, a product of accumulation of multiple genetic and epigenetic alterations and ambient factors, with a marked difference at each stage of the disease model (metaplasia-dysplasia carcinoma and adenoma-carcinoma) [123,124]. However, information regarding the molecular and genetic alterations in GBC is still scarce. At present the miRNAs emerge as an important family of molecules with promising prospects as biomarkers and therapy targets. As biomarkers, may be useful to assess either the tumor type, progression grade, response to chemotherapy or prognosis much better than traditional gene expression studies, providing important information for physicians and patients. Unfortunately miRNAs has not been evaluated in blood samples of GBC patients. Moreover, currently the design of new cancer treatments based on the molecular and genetic knowledge of the disease has been important in order to complement and enhance the mechanism of action through the combined use of these novel strategies with conventional therapy. This approach would be useful to lessen the adverse effects that may affect the quality of life of patients, mainly because synergistic action may require a reduction in dose, obtaining a more effective therapy with less side effects [125]. Several studies have evaluated the effect of ectopic expression of miRNA or repression by inhibitors of miRNAs in cell lines and animal models. For example, in hepatocarcinoma cell lines has been reported that the re-expression of miR-1 with hypomethylating agents causes cell cycle arrest and induction of apoptosis [104]. The intratumoral injection of exogenous let-7 miRNA blocked tumor development in mouse models of lung cancer [126] and the inhibition of miR-132 prevents angiogenesis in an orthotopic xenograft mouse model of human breast carcinoma [127]. The first human clinical trial has used LNA-anti-miR-122 (locked-nucleic-acid antisense oligonucleotides) against a highly conserved site in the genome of hepatitis C virus. The results have shown this therapy has a potent anti-viral activity, and currently is being evaluated in a phase II clinical trial [128-130]. Despite this promising result, the efficacy and safety of miRNA therapy should be carefully evaluated because the response depends on the epigenetic and genetic profile of each individual. All these approaches are still at an early stage, but with the development of new technologies, especially improving the specific delivery of tumorsuppressor miRNAs into damaged tissues, this strategy may become an important tool in diagnosis and treatment of this disease.

References

1. Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, et al. MicroRNA expression profiles classify human cancers. Nature. 2005; 435: 834-838.
2. Nikitina EG, Urazova LN, Stegny VN. MicroRNAs and human cancer. Exp Oncol. 2012; 34: 2-8.
3. Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J, et al. The nuclear RNase III Drosha initiates microRNA processing. Nature. 2003; 425: 415-419.
4. Lee Y, Kim M, Han J, Yeom KH, Lee S, Baek SH, et al. MicroRNA genes are transcribed by RNA polymerase II. EMBO J. 2004; 23: 4051-4060.
5. Borchert GM, Lanier W, Davidson BL. RNA polymerase III transcribes human microRNAs. Nat Struct Mol Biol. 2006; 13: 1097-1101.
6. Filippov V, Solovyev V, Filippova M, Gill SS. A novel type of RNase III family proteins in eukaryotes. Gene. 2000; 245: 213-221.
7. Bohnsack MT, Czaplinski K, Gorlich D. Exportin 5 is a RanGTP-dependent dsRNA-binding protein that mediates nuclear export of pre-miRNAs. RNA. 2004; 10: 185-191.
8. Lau PW, Guiley KZ, De N, Potter CS, Carragher B, MacRae IJ. The molecular architecture of human Dicer. Nat Struct Mol Biol. 2012; 19: 436-440.
9. Lau PW, MacRae IJ. The molecular machines that mediate microRNA maturation. J Cell Mol Med. 2009; 13: 54-60.
10. Kim VN, Han J, Siomi MC. Biogenesis of small RNAs in animals. Nat Rev Mol Cell Biol. 2009; 10: 126-139.
11. Kawamata T, Seitz H, Tomari Y. Structural determinants of miRNAs for RISC loading and slicer-independent unwinding. Nat Struct Mol Biol. 2009; 16: 953-960.
12. Westholm JO, Lai EC. Mirtrons: microRNA biogenesis via splicing. Biochimie. 2011; 93: 1897-1904.
13. Berezikov E1, Chung WJ, Willis J, Cuppen E, Lai EC. Mammalian mirtron genes. Mol Cell. 2007; 28: 328-336.
14. Yang JS, Maurin T, Robine N, Rasmussen KD, Jeffrey KL, Chandwani R, et al. Conserved vertebrate mir-451 provides a platform for Dicer-independent, Ago2-mediated microRNA biogenesis. Proc Natl Acad Sci U S A. 2010; 107: 15163-15168.
15. Chen CZ, Li L, Lodish HF, Bartel DP. MicroRNAs modulate hematopoietic lineage differentiation. Science. 2004; 303: 83-86.
16. Croce CM, Calin GA. miRNAs, cancer, and stem cell division. Cell. 2005; 122: 6-7.
17. Garzon R, Fabbri M, Cimmino A, Calin GA, Croce CM. MicroRNA expression and function in cancer. Trends Mol Med. 2006; 12: 580-587.
18. Cho WC. OncomiRs: the discovery and progress of microRNAs in cancers. Mol Cancer. 2007; 6: 60.
19. Bandres E, Cubedo E, Agirre X, Malumbres R, Zarate R, Ramirez N, et al. Identification by Real-time PCR of 13 mature microRNAs differentially expressed in colorectal cancer and non-tumoral tissues. Mol Cancer. 2006; 5: 29.
20. Hwang JH, Voortman J, Giovannetti E, Steinberg SM, Leon LG, Kim YT, et al. Identification of microRNA-21 as a biomarker for chemoresistance and clinical outcome following adjuvant therapy in respectable pancreatic cancer. PLoS One. 2010; 5: e10630.
21. Shinozaki A, Sakatani T, Ushiku T, Hino R, Isogai M, Ishikawa S, et al. Down regulation of MicroRNA-200 in EBV-Associated Gastric Carcinoma. Cancer Res. 2010; 70: 4719-4727.
22. Zhou M, Liu Z, Zhao Y, Ding Y, Liu H, Xi Y, et al. MicroRNA-125b confers the resistance of breast cancer cells to paclitaxel through suppression of pro-apoptotic Bcl-2 antagonist killer 1 (Bak1) expression. J Biol Chem. 2010; 285: 21496-21507.
23. Hundal R, Shaffer EA. Gallbladder cancer: epidemiology and outcome. Clin Epidemiol. 2014; 6: 99-109.
24. Misra S, Chaturvedi A, Misra NC, Sharma ID. Carcinoma of the gallbladder. Lancet Oncol. 2003; 4: 167-176.
25. Srivastava K, Srivastava A, Mittal B. Common genetic variants in pre-microRNAs and risk of gallbladder cancer in North Indian population. J Hum Genet. 2010; 55: 495-499.
26. Kitamura T, Connolly K, Ruffino L, Ajiki T, Lueckgen A, DiGiovanni J, et al. The therapeutic effect of histone deacetylase inhibitor PCI-24781 on gallbladder carcinoma in BK5.erbB2 mice. J Hepatol. 2012; 57: 84-91.
27. Miyahara N, Shoda J, Kawamoto T, Ishida H, Ueda T, Akimoto Y, et al. Interaction of Muc4 and ErbB2 in a transgenic mouse model of gallbladder carcinoma: Potential pathobiological implications. Oncol Rep. 2014; 32: 1796-1802.
28. Shu GS, Yang ZL, Liu DC. Immunohistochemical study of Dicer and Drosha expression in the benign and malignant lesions of gallbladder and their clinicopathological significances. Pathol Res Pract. 2012; 208: 392-397.
29. Migliore C, Martin V, Leoni VP, Restivo A, Atzori L, Petrelli A, et al. MiR-1 downregulation cooperates with MACC1 in promoting MET overexpression in human colon cancer. Clin Cancer Res. 2012; 18: 737-747.
30. Akao Y, Nakagawa Y, Naoe T. MicroRNAs 143 and 145 are possible common onco-microRNAs in human cancers. Oncol Rep. 2006; 16: 845-850.
31. Hudson RS, Yi M, Esposito D, Watkins SK, Hurwitz AA, Yfantis HG, et al. MicroRNA-1 is a candidate tumor suppressor and prognostic marker in human prostate cancer. Nucleic Acids Res. 2011; 40: 3689-3703.
32. Leone V, D'Angelo D, Rubio I, de Freitas PM, Federico A, Colamaio M, et al. MiR-1 is a tumor suppressor in thyroid carcinogenesis targeting CCND2, CXCR4, and SDF-1alpha. J Clin Endocrinol Metab. 2011; 96: E1388-1398.
33. Nohata N, Hanazawa T, Kikkawa N, Sakurai D, Sasaki K, Chiyomaru T, et al. Identification of novel molecular targets regulated by tumor suppressive miR-1/miR-133a in maxillary sinus squamous cell carcinoma. Int J Oncol. 2011; 39: 1099-1107.
34. Akao Y, Nakagawa Y, Kitade Y, Kinoshita T, Naoe T. Downregulation of microRNAs-143 and -145 in B-cell malignancies. Cancer Sci. 2007; 98: 1914-1920.
35. Lehmann U, Streichert T, Otto B, Albat C, Hasemeier B, Christgen H, et al. Identification of differentially expressed microRNAs in human male breast cancer. BMC Cancer. 2010; 10: 109.
36. Letelier P, Garcia P, Leal P, Alvarez H, Ili C, Lopez J, et al. miR-1 and miR-145 act as tumor suppressor microRNAs in gallbladder cancer. Int J Clin Exp Pathol. 2014; 7: 1849-1867.
37. Zhou H, Guo W, Zhao Y, Wang Y, Zha R, Ding J, et al. MicroRNA-135a acts as a putative tumor suppressor by directly targeting very low density lipoprotein receptor in human gallbladder cancer. Cancer Sci. 2014; 105: 956-965.
38. Nasser MW, Datta J, Nuovo G, Kutay H, Motiwala T, Majumder S, et al. Down-regulation of micro-RNA-1 (miR-1) in lung cancer. Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin-induced apoptosis by miR-1. J Biol Chem. 2008; 283: 33394-33405.
39. Chiyomaru T, Enokida H, Kawakami K, Tatarano S, Uchida Y, Kawahara K, et al. Functional role of LASP1 in cell viability and its regulation by microRNAs in bladder cancer. Urol Oncol. 2012; 30: 434-443.
40. Yoshino H, Enokida H, Chiyomaru T, Tatarano S, Hidaka H, Yamasaki T, et al. Tumor suppressive microRNA-1 mediated novel apoptosis pathways through direct inhibition of splicing factor serine/arginine-rich 9 (SRSF9/SRp30c) in bladder cancer. Biochem Biophys Res Commun. 2012; 417: 588-593.
41. Wu CD, Kuo YS, Wu HC, Lin CT. MicroRNA-1 induces apoptosis by targeting prothymosin alpha in nasopharyngeal carcinoma cells. J Biomed Sci. 2011; 18: 80.
42. Wang F, Song G, Liu M, Li X, Tang H. miRNA-1 targets fibronectin1 and suppresses the migration and invasion of the HEp2 laryngeal squamous carcinoma cell line. FEBS Lett. 2011; 585: 3263-3269.
43. Zhou H, Guo W, Zhao Y, Wang Y, Zha R, Ding J, et al. MicroRNA-26a acts as a tumor suppressor inhibiting gallbladder cancer cell proliferation by directly targeting HMGA2. Int J Oncol. 2014; 44: 2050-2058.
44. Koul HK, Pal M, Koul S. Role of p38 MAP Kinase Signal Transduction in Solid Tumors. Genes Cancer. 2013; 4: 342-359.
45. Jin K, Xiang Y, Tang J, Wu G, Li J, Xiao H, et al. miR-34 is associated with poor prognosis of patients with gallbladder cancer through regulating telomere length in tumor stem cells. Tumour Biol. 2014; 35: 1503-1510.
46. Xu L, Li S, Stohr BA. The role of telomere biology in cancer. Annu Rev Pathol. 2013; 8: 49-78.
47. Misso G, Di Martino MT, De Rosa G, Farooqi AA, Lombardi A, Campani V, et al. Mir-34: a new weapon against cancer? Mol Ther Nucleic Acids. 2014; 3: e194.
48. Peng HH, Zhang YD, Gong LS, Liu WD, Zhang Y. Increased expression of microRNA-335 predicts a favorable prognosis in primary gallbladder carcinoma. Onco Targets Ther. 2013; 6: 1625-1630.
49. Png KJ, Yoshida M, Zhang XH, Shu W, Lee H, Rimner A, et al. MicroRNA-335 inhibits tumor reinitiation and is silenced through genetic and epigenetic mechanisms in human breast cancer. Genes Dev. 2011; 25: 226-231.
50. Lynch J, Meehan MH, Crean J, Copeland J, Stallings RL, Bray IM. Metastasis suppressor microRNA-335 targets the formin family of actin nucleators. PLoS One. 2013; 8: e78428.
51. Wang Y, Zhao W, Fu Q. miR-335 suppresses migration and invasion by targeting ROCK1 in osteosarcoma cells. Mol Cell Biochem. 2013; 384: 105-111.
52. Gong M, Ma J, Guillemette R, Zhou M, Yang Y, Yang Y, et al. miR-335 inhibits small cell lung cancer bone metastases via IGF-IR and RANKL pathways. Mol Cancer Res. 2014; 12: 101-110.
53. Zhang H, Luo XQ, Zhang P, Huang LB, Zheng YS, Wu J, et al. MicroRNA patterns associated with clinical prognostic parameters and CNS relapse prediction in pediatric acute leukemia. PLoS One. 2009; 4: e7826.
54. Ma MZ, Li CX, Zhang Y, Weng MZ, Zhang MD, Qin YY, et al. Long non-coding RNA HOTAIR, a c-Myc activated driver of malignancy, negatively regulates miRNA-130a in gallbladder cancer. Mol Cancer. 2014; 13: 156.
55. Gupta RA, Shah N, Wang KC, Kim J, Horlings HM, Wong DJ, et al. Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature. 2010; 464: 1071-1076.
56. Roukos DH. Chromatin: a key player in complex gene regulation and future cancer therapeutics. Epigenomics. 2011; 3: 395-399.
57. Ma MZ, Chu BF, Zhang Y, Weng MZ, Qin YY, Gong W, et al. Long non-coding RNA CCAT1 promotes gallbladder cancer development via negative modulation of miRNA-218-5p. Cell Death Dis. 2015; 6: e1583.
58. Boll K, Reiche K, Kasack K, Morbt N, Kretzschmar AK, Tomm JM, et al. MiR-130a, miR-203 and miR-205 jointly repress key oncogenic pathways and are downregulated in prostate carcinoma. Oncogene. 2013; 32: 277-285.
59. Zhang X, Huang L, Zhao Y, Tan W. Downregulation of miR-130a contributes to cisplatin resistance in ovarian cancer cells by targeting X-linked inhibitor of apoptosis (XIAP) directly. Acta Biochim Biophys Sin (Shanghai). 2013; 45: 995-1001.
60. Zhu Z, Xu Y, Du J, Tan J, Jiao H. Expression of microRNA-218 in human pancreatic ductal adenocarcinoma and its correlation with tumor progression and patient survival. J Surg Oncol. 2014; 109: 89-94.
61. Yamasaki T, Seki N, Yoshino H, Itesako T, Hidaka H, Yamada Y, et al. MicroRNA-218 inhibits cell migration and invasion in renal cell carcinoma through targeting caveolin-2 involved in focal adhesion pathway. J Urol. 2013; 190: 1059-1068.
62. Chen Y, Gorski DH. Regulation of angiogenesis through a microRNA (miR-130a) that down-regulates antiangiogenic homeobox genes GAX and HOXA5. Blood. 2008; 111: 1217-1226.
63. Kono H, Nakamura M, Ohtsuka T, Nagayoshi Y, Mori Y, Takahata S, et al. High expression of microRNA-155 is associated with the aggressive malignant behavior of gallbladder carcinoma. Oncol Rep. 2013; 30: 17-24.
64. Ryu JK, Hong SM, Karikari CA, Hruban RH, Goggins MG, Maitra A. Aberrant MicroRNA-155 expression is an early event in the multistep progression of pancreatic adenocarcinoma. Pancreatology. 2010; 10: 66-73.
65. Zhang GJ, Xiao HX, Tian HP, Liu ZL, Xia SS, Zhou T. Upregulation of microRNA-155 promotes the migration and invasion of colorectal cancer cells through the regulation of claudin-1 expression. Int J Mol Med. 2013; 31: 1375-1380.
66. Ling N, Gu J, Lei Z, Li M, Zhao J, Zhang HT, et al. microRNA-155 regulates cell proliferation and invasion by targeting FOXO3a in glioma. Oncol Rep. 2013; 30: 2111-2118.
67. Cai ZK, Chen Q, Chen YB, Gu M, Zheng DC, Zhou J, et al. microRNA-155 promotes the proliferation of prostate cancer cells by targeting annexin 7. Mol Med Rep. 2015; 11: 533-538.
68. Chang Y, Liu C, Yang J, Liu G, Feng F, Tang J, et al. MiR-20a triggers metastasis of gallbladder carcinoma. J Hepatol. 2013; 59: 518-527.
69. Olive V, Jiang I, He L. mir-17-92, a cluster of miRNAs in the midst of the cancer network. Int J Biochem Cell Biol. 2010; 42: 1348-1354.
70. Munoz-Garrido P, Garcia-Fernandez de Barrena M, Hijona E, Carracedo M, Marin JJ, Bujanda L, et al. MicroRNAs in biliary diseases. World J Gastroenterol. 2012; 18: 6189-6196.
71. Zhu H, Han C, Lu D, Wu T. miR-17-92 cluster promotes cholangiocarcinoma growth: evidence for PTEN as downstream target and IL-6/Stat3 as upstream activator. Am J Pathol. 2014; 184: 2828-2839.
72. Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, et al. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci. USA. 2006; 103: 2257-2261.
73. Wang Z, Wang B, Shi Y, Xu C, Xiao HL, Ma LN, et al. Oncogenic miR-20a and miR-106a enhance the invasiveness of human glioma stem cells by directly targeting TIMP-2. Oncogene. 2014;.
74. Qiang XF, Zhang ZW, Liu Q, Sun N, Pan LL, Shen J, et al. miR-20a promotes prostate cancer invasion and migration through targeting ABL2. J Cell Biochem. 2014; 115: 1269-1276.
75. Zhou J, Liu R, Luo C, Zhou X, Xia K, Chen X, et al. MiR-20a inhibits cutaneous squamous cell carcinoma metastasis and proliferation by directly targeting LIMK1. Cancer Biol Ther. 2014; 15: 1340-1349.
76. Qiu Y, Luo X, Kan T, Zhang Y, Yu W, Wei Y, et al. TGF-β up regulates miR-182 expression to promote gallbladder cancer metastasis by targeting CADM1. Mol Biosyst. 2014; 10: 679-685.
77. Kong WQ, Bai R, Liu T, Cai CL, Liu M, Li X, et al. MicroRNA-182 targets cAMP-responsive element-binding protein 1 and suppresses cell growth in human gastric adenocarcinoma. FEBS J. 2012; 279: 1252-1260.
78. Xu X, Dong Z, Li Y, Yang Y, Yuan Z, Qu X, et al. The upregulation of signal transducer and activator of transcription 5-dependent microRNA-182 and microRNA-96 promotes ovarian cancer cell proliferation by targeting forkhead box O3 upon leptin stimulation. Int J Biochem Cell Biol. 2013; 45: 536-545.
79. Li P, Sheng C, Huang L, Zhang H, Huang L, Cheng Z, et al. MiR-183/-96/-182 cluster is up-regulated in most breast cancers and increases cell proliferation and migration. Breast Cancer Res. 2014; 16: 473.
80. Chen Q, Yang L, Xiao Y, Zhu J, Li Z. Circulating microRNA-182 in plasma and its potential diagnostic and prognostic value for pancreatic cancer. Med Oncol. 2014; 31: 225.
81. Wang S, Yang MH, Wang XY, Lin J, Ding YQ. Increased expression of miRNA-182 in colorectal carcinoma: an independent and tissue-specific prognostic factor. Int J Clin Exp Pathol. 2014; 7: 3498-3503.
82. Segura MF, Hanniford D, Menendez S, Reavie L, Zou X, Alvarez-Diaz S, et al. Aberrant miR-182 expression promotes melanoma metastasis by repressing FOXO3 and microphthalmia-associated transcription factor. Proc Natl Acad Sci. USA. 2009; 106: 1814-1819.
83. Qu Y, Li WC, Hellem MR, Rostad K, Popa M, McCormack E, et al. MiR-182 and miR-203 induce mesenchymal to epithelial transition and self-sufficiency of growth signals via repressing SNAI2 in prostate cells. Int J Cancer. 2013; 133: 544-555.
84. Li C, Du X, Tai S, Zhong X, Wang Z, Hu Z, et al. GPC1 regulated by miR-96-5p, rather than miR-182-5p, in inhibition of pancreatic carcinoma cell proliferation. Int J Mol Sci. 2014; 15: 6314-6327.
85. Wang PY, Gong HT, Li BF, Lv CL, Wang HT, Zhou HH, et al. Higher expression of circulating miR-182 as a novel biomarker for breast cancer. Oncol Lett. 2013; 6: 1681-1686.
86. Zheng D, Haddadin S, Wang Y, Gu LQ, Perry MC, Freter CE, et al. Plasma microRNAs as novel biomarkers for early detection of lung cancer. Int J Clin Exp Pathol. 2011; 4: 575-586.
87. Gupta SK, Shukla VK. Gall Bladder Cancer Etiopathology and Treatment. Health Administrator XVII: 134-142.
88. Roa I, Araya JC, Villaseca M, De Aretxabala X, Riedemann P, Endoh K, et al. Preneoplastic lesions and gallbladder cancer: an estimate of the period required for progression. Gastroenterology. 1996; 111: 232-236.
89. Farazi TA, Hoell JI, Morozov P, Tuschl T. MicroRNAs in human cancer. Adv Exp Med Biol. 2013; 774: 1-20.
90. Zhang J, Han C, Wu T. MicroRNA-26a promotes cholangiocarcinoma growth by activating β-catenin. Gastroenterology. 2012; 143: 246-256.
91. Meng F, Henson R, Lang M, Wehbe H, Maheshwari S, Mendell JT, et al. Involvement of human micro-RNA in growth and response to chemotherapy in human cholangiocarcinoma cell lines. Gastroenterology. 2006; 130: 2113-2129.
92. Chen X, Chen J, Liu X, Guo Z, Sun X, Zhang J. The real-time dynamic monitoring of microRNA function in cholangiocarcinoma. PLoS One. 2014; 9: e99431.
93. Selaru FM, Olaru AV, Kan T, David S, Cheng Y, Mori Y, et al. MicroRNA-21 is overexpressed in human cholangiocarcinoma and regulates programmed cell death 4 and tissue inhibitor of metalloproteinase 3. Hepatology. 2009; 49: 1595-1601.
94. Edge SB, Compton CC. The American Joint Committee on Cancer: the 7th edition of the AJCC cancer staging manual and the future of TNM. Ann Surg Oncol. 2010; 17: 1471-1474.
95. Ding XC, Weiler J, Grosshans H. Regulating the regulators: mechanisms controlling the maturation of microRNAs. Trends Biotechnol. 2009; 27: 27-36.
96. Calin GA, Sevignani C, Dumitru CD, Hyslop T, Noch E, Yendamuri S, et al. Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. Proc Natl Acad Sci U S A. 2004; 101: 2999-3004.
97. Jay C, Nemunaitis J, Chen P, Fulgham P, Tong AW. miRNA profiling for diagnosis and prognosis of human cancer. DNA Cell Biol. 2007; 26: 293-300.
98. Zhao S, Ye X, Xiao L, Lian X, Feng Y, Li F, et al. MiR-26a inhibits prostate cancer progression by repression of Wnt5a. Tumour Biol. 2014; 35: 9725-9733.
99. Lee Y, Jeon K, Lee JT, Kim S, Kim VN. MicroRNA maturation: stepwise processing and subcellular localization. EMBO J. 2002; 21: 4663-4670.
100. Calin GA, Croce CM. MicroRNA signatures in human cancers. Nat Rev Cancer. 2006; 6: 857-866.
101. Ozsolak F, Poling LL, Wang Z, Liu H, Liu XS, Roeder RG, et al. Chromatin structure analyses identify miRNA promoters. Genes Dev. 2008; 22: 3172-3183.
102. Lujambio A, Esteller M. CpG island hypermethylation of tumor suppressor microRNAs in human cancer. Cell Cycle. 2007; 6: 1455-1459.
103. Davis-Dusenbery BN, Hata A. Mechanisms of control of microRNA biogenesis. J Biochem. 2010; 148: 381-392.
104. Datta J, Kutay H, Nasser MW, Nuovo GJ, Wang B, Majumder S, et al. Methylation mediated silencing of MicroRNA-1 gene and its role in hepatocellular carcinogenesis. Cancer Res. 2008; 68: 5049-5058.
105. Suzuki H, Takatsuka S, Akashi H, Yamamoto E, Nojima M, Maruyama R, et al. Genome-wide profiling of chromatin signatures reveals epigenetic regulation of MicroRNA genes in colorectal cancer. Cancer Res. 2011; 71: 5646-5658.
106. Suh SO, Chen Y, Zaman MS, Hirata H, Yamamura S, Shahryari V, et al. MicroRNA-145 is regulated by DNA methylation and p53 gene mutation in prostate cancer. Carcinogenesis. 2011; 32: 772-778.
107. Zaman MS, Chen Y, Deng G, Shahryari V, Suh SO, Saini S, et al. The functional significance of microRNA-145 in prostate cancer. Br J Cancer. 2010; 103: 256-264.
108. Sandhu R, Rivenbark AG, Mackler RM, Livasy CA, Coleman WB. Dysregulation of microRNA expression drives aberrant DNA hypermethylation in basal-like breast cancer. Int J Oncol. 2014; 44: 563-572.
109. Cui X, Zhao Z, Liu D, Guo T, Li S, Hu J, et al. Inactivation of miR-34a by aberrant CpG methylation in Kazakh patients with esophageal carcinoma. J Exp Clin Cancer Res. 2014; 33: 20.
110. Chen X, Hu H, Guan X, Xiong G, Wang Y, Wang K, et al. CpG island methylation status of miRNAs in esophageal squamous cell carcinoma. Int J Cancer. 2012; 130: 1607-1613.
111. Li H, Yu G, Shi R, Lang B, Chen X, Xia D, et al. Cisplatin-induced epigenetic activation of miR-34a sensitizes bladder cancer cells to chemotherapy. Mol Cancer. 2014; 13: 8.
112. Roy S, Levi E, Majumdar AP, Sarkar FH. Expression of miR-34 is lost in colon cancer which can be re-expressed by a novel agent CDF. J Hematol Oncol. 2012; 5: 58.
113. Dohi O, Yasui K, Gen Y, Takada H, Endo M, Tsuji K, et al. Epigenetic silencing of miR-335 and its host gene MEST in hepatocellular carcinoma. Int J Oncol. 2013; 42: 411-418.
114. Krzeminski P, Sarasquete ME, Misiewicz-Krzeminska I, Corral R, Corchete LA, Martín AA, et al. Insights into epigenetic regulation of microRNA-155 expression in multiple myeloma. Biochim Biophys Acta. 2014;.
115. Dakhlallah D, Batte K, Wang Y, Cantemir-Stone CZ, Yan P, Nuovo G, et al. Epigenetic regulation of miR-17~92 contributes to the pathogenesis of pulmonary fibrosis. Am J Respir Crit Care Med. 2013; 187: 397-405.
116. Cheung HH, Davis AJ, Lee TL, Pang AL, Nagrani S, Rennert OM, et al. Methylation of an intronic region regulates miR-199a in testicular tumor malignancy. Oncogene. 2011; 30: 3404-3415.
117. Thomson JM, Newman M, Parker JS, Morin-Kensicki EM, Wright T, Hammond SM. Extensive post-transcriptional regulation of microRNAs and its implications for cancer. Genes Dev. 2006; 20: 2202-2207.
118. Karube Y, Tanaka H, Osada H, Tomida S, Tatematsu Y, Yanagisawa K, et al. Reduced expression of Dicer associated with poor prognosis in lung cancer patients. Cancer Sci. 2005; 96: 111-115.
119. Zhu DX, Fan L, Lu RN, Fang C, Shen WY, Zou ZJ, et al. Downregulated Dicer expression predicts poor prognosis in chronic lymphocytic leukemia. Cancer Sci. 2012; 103: 875-881.
120. Gillies JK, Lorimer IA. Regulation of p27Kip1 by miRNA 221/222 in glioblastoma. Cell Cycle. 2007; 6: 2005-2009.
121. Hill DA, Ivanovich J, Priest JR, Gurnett CA, Dehner LP, Desruisseau D, et al. DICER1 mutations in familial pleuropulmonary blastoma. Science. 2009; 325: 965.
122. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell. 2011; 144: 646-674.
123. Gourgiotis S, Kocher HM, Solaini L, Yarollahi A, Tsiambas E, Salemis NS. Gallbladder cancer. Am J Surg. 2008; 196: 252-264.
124. Letelier P, Brebi P, Tapia O, Roa JC. DNA promoter methylation as a diagnostic and therapeutic biomarker in gallbladder cancer. Clin Epigenetics. 2012; 4: 11.
125. LoRusso PM, Canetta R, Wagner JA, Balogh EP, Nass SJ, Boerner SA, et al. Accelerating cancer therapy development: the importance of combination strategies and collaboration. Summary of an Institute of Medicine workshop. Clin Cancer Res. 2012; 18: 6101-6109.
126. Trang P, Medina PP, Wiggins JF, Ruffino L, Kelnar K, Omotola M, et al. Regression of murine lung tumors by the let-7 microRNA. Oncogene. 2010; 29: 1580-1587.
127. Anand S, Majeti BK, Acevedo LM, Murphy EA, Mukthavaram R, Scheppke L, et al. MicroRNA-132-mediated loss of p120RasGAP activates the endothelium to facilitate pathological angiogenesis. Nat Med. 2010; 16: 909-914.
128. Broderick JA, Zamore PD. MicroRNA therapeutics. Gene Ther. 2011; 18: 1104-1110.
129. Iorio MV, Croce CM. MicroRNA dysregulation in cancer: diagnostics, monitoring and therapeutics. A comprehensive review. EMBO Mol Med. 2012; 4: 143-159.
130. Zuker M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003; 31: 3406-3415.