Immunological Properties Validated by the A. Rubens Sea Star Immunoglobulin Kappa Gene

Abstract

In 2013-2014, we had discovered a sea star Igkappa gene, showing 2 Ig sites, after star sea immunizations to HRP.The gene showed a specific immune response to the enzyme HRP, after its insertion in an Escherichia coli plasmid.

Keywords: Sea star IgKappa gene; Plasmid; Enzymatic assay; Immune reaction

Introduction

The general idea that emerged from the experiments, made in our laboratories, was that Echinodermata , as exemplified by sea stars : Asterina gibbosa and Asterias rubens, possessed an immune system, with B sea star lymphocytes, able to mount cellular and humoral-specific responses [1]. Asterias rubens produced « An antibody » anti HRP, after injections to HRP: it was shown to correlate to kappa genes,in 2011 [2]. In 2013-2014 a sea star Ig Kappa gene to HRP was cloned [3,4].

But a question deserved to be put : did the cloned gene keep the property to induce a specific immune response managed specifically against the used antigen namely HRP (Horse -radish Peroxydase)? It is the object of this work which required, in the first place to make an Escherichia coli plasmid and secondarily to perform an enzyme assay by the contribution of its substratum, to see if the « antibody » is bound in the HRP antigen.

Materials and Methods

Animals

As precedently [3] we used sea stars immunized to HRP and their transcriptome.

Plasmid construction

GZK-2SMART cDNA was amplified in standard PCR.

Conditions using primers

5' TAAGGATCCTATGCGTGGCAACATGGCGT and 5' TATAAGCTTACGCAAACATCTGACAGCGG. PCR-amplified DNA was treated with restriction enzymes BamH I and Hind III and inserted into the corresponding sites of pTR-HIS (Lifetechnologies). Final construction was checked by sequencing.

Sonication

The sonication of control E.coli cultures and treated E.coli ones were performed with a sonicator. (VIBRACELL 75115). Control lysates and treated lysates were obtained and placed in PBS.

Enzymologic assay

Dosage of Horse-radish peroxydase was performed in microtitration plaque. Control and treated lysates were incubated in presence of 50μl HRP/ well. Endogenous peroxydase was studied and directly revealed, in controls, by ABTS ( 3-ethylbenzthiazoline-6- sulfonic acid+H2O2) Experiments were done in duplicate.

Results

Results were summarized in figure 1. The comparison (Figure 1) between control lysates (Bacterial positive lysates with peroxydase) and treated ones indicated a significant difference. Optical density at 405 nm in treated lysates showed the presence of bounding peroydase (HRP), especially at a dilution of 1, in a degree upper to that of the controls (controls incubated in presence or not of HRP).

Figure 1 : HRP « fixation » in control lysates and treated lysates.