Lichtheimia ramosa Mucormycosis in a Bottlenose Dolphin

Case Report

Austin J Vet Sci & Anim Husb. 2019; 6(3): 1064.

Lichtheimia ramosa Mucormycosis in a Bottlenose Dolphin

Dhib I1*, Yaacoub A1, Chouaieb H1, Jaim A2, Ben Said M1, Letscher V3 and Fathallah A1

¹Parasitology-Mycology Laboratory, Farhat Hached Hospital, Sousse, Tunisia

²Animal Presidential Park of Libreville, Tunisia

³Institut of Parasitology and Tropical Pathology of Faculty of Medicine of Strasbourg, France

*Corresponding author: Imen Dhib, Faculty of Medicine, Parasitology-Mycology laboratory, Mohamed El Karoui Street, 4002 Sousse, Tunisia

Received: November 20, 2019; Accepted: December 18, 2019; Published: December 25, 2019

Abstract

5 years male subadult bottlenose dolphin (Tursiops truncatus) named “Pato” belonging to the oceanic dolphin family was maintained in Friguia Public Park Dolphinarium in Tunisia for two years dating from January 2010. The patient exhibited acute anorexia and gradual weight loss. The animal developed respiratory failure and died on September 2011 despite treatment including antibiotics and corticosteroids. Over the course of illness, fungal infection was not suspected. Post mortem histopathologic examination revealed the presence of irregular, thick, non-septate and fragmented hyphae consistent with a zygomycete infection. Lichtheimia ramosa was identified by morphological characteristics on fungal culture of tissues necropsy and confirmed by PCR sequencing ITS-5.8s-ITS2 ribosomal RNA gene. This is believed to be the first report of Lichtheimia ramosa mucormycosis in bottlenose dolphin.

Keywords: Pulmonary; Mucormycosis; Bottlenose Dolphin; Lichtheimia ramosa

Introduction

Mycoses are a significant cause of stranding in bottlenose dolphins (Tursiops truncatus) and are well documented in both captive and free-ranging individuals [1]. Aspergillus (Asp) fumigatus and less frequently Asp niger and Asp terreus are the more frequent causes of fungal pneumonia in marine mammels [2a]. Even though zygomycetes are more rarely observed in, marine mammals (bottlenose dolphins, harbor porpoises and killer whales) but they often cause rapid fatal disease. Common sites of infection by zygomycetes are the skin, the respiratory system and to a lesser extent the central nervous system [1,2b]. These infections are mainly observed in debilitated animals.

The present report describes a case of pulmonary mucormycosis in a juvenile bottlenose dolphin (Tursiops truncatus) caused by Lichtheimia ramosa. To our knowledge, it is the first case to be reported in a marine mammal.

Case Presentation

5 years male subadult bottlenose dolphin named “Pato” and belonging to the oceanic dolphin family has been maintained in Friguia Public Park Dolphinarium, Tunisia, for two years dating from January 2010.

In November 2010, the animal exhibited an acute anorexia and gradual weight loss. Blood analysis showed increased WBC and neutrophils’ count (25.3 103/μl, 91% respectively), increased Lactic Dehydrogenase (LDH), gamma glutamyl transferase (γGT), alkaline phosphatase (AP), amylase and lipase enzymes and Total Protein’s (TP) levels. Ciprofloxacine (1.75g/kg per os daily for 12 days) and ceftazidime (3.5g per os daily for 10 days) were administered. After a transient improvement, the state of the animal worsened again on January 2011. Hematological and serum biochemical analyses revealed persistent increasing levels of γGT, amylase and lipase enzymes. Corticosteroids were initiated on January 7th 2011 and continued for 8 months (Dexamethasone [2 to 15 mg daily] for 4 days, then continued for 3 months [0.5 to 10 mg] and followed by Prednisone (55 to 110 mg daily for 5 months). On January 14th, fecal culture grew Echerichia coli and Pseudomonas aeroginosa. Pseudomonas aeroginosa was also isolated from the nasal swab. Despite these results, antibiotics were not administered. Over the next 7 months, Pato exhibited alternant periods of anorexia with perturbation of attention and transient improvement.

On August 2011, one month before death, the animal state dramatically worsened. Hematological and biochemical examinations revealed an elevated WBC count, marked thrombocytopenia and a marked increase of AST (540U/l), ALT (277 U/l), γ GT (413U/l), AP (670U/l), amylase, lipase enzyme and TP levels (9.6g/dl). In addition, blood levels of sodium and chloride were increased (164mEq/l and 129 mEq/l respectively). It is worth mentioning that the level of Total Bilirubin (TB) was increased all over the period of captivity of the animal, while Blood Urea Nitrogen (BUN), glycemia and creatinine concentrations were within reference intervals. Further fecal culture grew Pseudomonas aeroginosa. Enrofloxacine was initiated (525 mg/ kg/day for 6 days) followed by Amikacine (0.75 g/kg/day increased to 1.5g for 7 days) and by Ceftazidime (3.5 g/kg/day for 6 days). Despite antibiotics and corticosteroids treatment, Pato developed respiratory failure and died on September 7th 2011.

Necropsy examination was performed. Samples taken from the lung, trachea and lymph nodes showed an irregular, thick, nonseptate and fragmented mycelial filaments (Figure 1) and some necrosis foci inside a granulomatous chronic inflammation.

Figure 1: Irregular, thick, non-septate and fragmented hyphae (arrows). Pulmonary tissues necropsy (periodic acid-Schiff reaction) X400.

    

    
    

    

    Figure 1: Irregular, thick, non-septate and fragmented hyphae (arrows).
Pulmonary tissues necropsy (periodic acid-Schiff reaction) X400.

Direct mycological examination of lung specimens showed large and non-septal hyphae. Fungal culture grew mycelia colonies identified as lichthemia sp on the basis of morphological characteristics (Figure 2). Colonies were white with a cottony texture. Reverse was uncolored. Microscopically, colonies were consisted of large, non-septate branching hyphae with funnel-shaped apophysis. Identification was further confirmed by PCR and sequence analysis. The following primers were used (ITS1: 5’ GTTCCTCACAGTTTTGTGCA 3’/ ITS4: 5’ TTGATTTCAGATCTAGATGT 3’) targeting the ribosomal Internal Transcribed Space (ITS) of ribosomal DNA. These primers amplify a 735 bp fragment. The sequence alignment of the strain in GenBank database showed 100% homology with lichtheimia ramosa registered as lichtheimia ramosa strain SN-A2 18S HQ285688.

Figure 2: Macroscopic feature of Lichtheimia ramosa in culture on Sabouraud dextrose agar medium.

    

    
    

    

    Figure 2: Macroscopic feature of Lichtheimia ramosa in culture on Sabouraud
dextrose agar medium.

Discussion

Fungal diseases are well documented in captive and free ranging bottlenose dolphins (Tursiops truncatus) [3,6]. Common sites of infection include the skin and respiratory tract [7,8]. Systemic and central nervous system infections have been more rarely reported [1,9].

Pulmonary Aspergillosis is the most frequent mycosis in cetaceans [10]. Among the non-Aspergillus species, zygomycetes, known as ubiquitous opportunistic soil inhabitants, are the most commonly reported. Prognosis of zygomycosis is usually poor because of the rapid dissemination of the disease and it’s fatal outcome [11].

Predisposing factors include traumatic tissue damage and prolonged corticotherapy [11,12]. In our patient, the long-term use of antibiotics and corticosteroids together with the opportunistic Pseudomonas aeroginosa infection may have acted as predisposing factors and have accelerated the fatal outcome. Mucormycosis in dolphins has been reported to mainly involve central nervous system [1], lungs [13] and skin [14]. Systemic infection has also been reported [8]. Our patient developed a pulmonary infection known to range between the most frequent localizations.

Follow up laboratory testing revealed a high WBC count all over the course of our dolphin disease. Leukocytosis has been reported to be a common finding in infected bottlenose dolphins whatever the infection agent [15]. Increased albumin concentrations, and increased AST, ALT, γGT activities observed in our dolphin are consistent with previous reports on aggressive mycoses [14]. On the other hand, it is known that corticosteroids treatment and skeletal muscle damage from overexertion can further enhance AST and ALT amounts [16].

Ionic perturbations, as those shown our patient, are less documented [2b].

In suspected cases of mucormycosis, diagnosis can be achieved by the demonstration of characteristic hyphae in biopsy specimens. However, in many cases the disease is only diagnosed on post mortem examination of necropsy specimens as the case reported herein. The species identification requires sporulation on culture media. However, cultures can be time-consuming and unreliable as some fungal species do not grow readily [7]. On the other hand, identification based on macroscopic and microscopic mycological characteristics may be difficult and misleading. Therefore, molecular techniques are the best alternative for an accurate identification of the pathogenic species.

Histopathological examination of the necropsy specimens taken from our dolphin showed irregular, thick, non-septate and fragmented hyphae consistent with a zygomycete.

Mycological examination showed the fungus to belong to the Lichtheimia genus; further identified as Lichtheimia ramosa by PCR sequencing ITS-5.8s-ITS2 ribosomal RNA gene. In previous reported cases of dolphin mucormycosis, molecular techniques used for the identification of the causal species include semi nested PCR and sequencing [17], PCR ITS1-ITS2 [13] and sequencing of D1/D2 of 26 rRNA [18]. Nearly all reported mucormycosis cases in dolphins were caused by one of the following species: Apophysomyces elegans [5,8,14,19]; Saksenaea vasiformis [14]; Rhizopus arrhizus [syn. R. oryzae] [13] and Cunninghamella bertholletiae [2b,18]. To our knowledge, our study is the first to report a zygomycosis case caused by Lichtheimia ramosa in a cetacean. Lichtheimia ramosa has already been reported as a causal agent of rhinocerebral zygomycosis in cattle [20] and systemic infection zygomycosis in bovines and other warmblooded animals [21]. In humans, members of the genus Lichtheimia are the second or the third more frequent agent of mucormycosis in Europe and Worldwide, following R. arrhizus (oryzae) which is the leading species worldwide [17] and in Tunisia [22].

In our dolphin fungal infection was not suspected over the course of the disease so that no antimycosics were administrated. Early diagnosis, aggressive surgical removal of the infected tissue and the use of posaconazole [19] would have been necessary for a successful outcome.

Conclusion

The present case emphasizes the pathogenic potential of Lichtheimia ramosa zygomycosis in marine mammals, as well as the potential role of opportunistic microflora, particularly P. aeroginosa in immunocompromised bottlenose dolphins. Because of the rapid and aggressive nature of the growth of these organisms, early detection and diagnosis of zygomycosis is critical for successful therapy.

Human and Animal Rights

This study did not contain any experiments involving human subjects. In addition, no animal experiments were performed in this study. The animal described in the present article was submitted as a necropsy sample after its death, and all of the procedures applied to the animal were approved by the Committee on the Ethics of Animal Experiments of Obihiro University of Agriculture and Veterinary Medicine. All applicable international, national, and institutional guidelines for the care of animals were followed.

References

  1. Marcos Isidoro-Ayza, Lola Perez, Javier Cabanes F, Gemma Castella, Marina Andres, Enric Vidal, et al. Central Nervous System Mucormycosis Caused by Cunninghamella Bertholletiae in a Bottlenose Dolphin (Tursiops truncatus) in Journal of Wildlife Diseases. 2014; 50: 634-638.
  2. Abdo W, Kawachi T, Sakai H, Fukushi H, Kano R, Shibahara T, et al. Disseminated mycosis in a killer whale (Orcinus orca). Journal of Veterinary Diagnostic Investigation. 2012; 24: 211-218.
  3. Abdo W, Kakizoe Y, Ryono M, Dover SR, Fukushi H, Okuda H, et al. Pulmonary zygomycosis with Cuninghamella bertholletiae in a killer whale (Orcinus orca). J Comp Pathol. 2012; 147: 94-99.
  4. Wünschmann A, Siebert U, Weiss R. Rhizopus mycosis in a harbor porpoise from the Baltic Sea. J Wildl Dis. 1999; 35: 569-573.
  5. Robeck TR, Dalton LM. Saksenaea vasiformis and Apophysomyces elegans zygomycotic infections in bottlenose dolphins (Tursiops truncatus), a killer whale (Orcinus orca), and pacific white-sided dolphins (Lagenorhynchus obliquidens). J Zoo Wildl Med. 2002; 33: 356-366.
  6. Staggs L, Leger J, Bossart G, Forrest I, Townsend Jr, Christie Hicks, et al. A Novel Case of Fusarium oxysporum Infection in an Atlantic Bottlenose Dolphin (Tursiops truncatus). Journal of Zoo and Wildlife Medicine. 2010; 41: 287-290.
  7. Huckabone SE, Gulland FMD, Johnson SM, Colegrove KM, Dodd EM, Pappagianis D, et al. Coccidioidomycosis and other systemic mycoses of marine mammals stranding along the central california, USA coast: 1998- 2012. Journal of Wildlife Diseases. 2015; 51: 295-308.
  8. Delaney MA, Terio1 KA, Colegrove KM, Briggs MB, Kinsel MJ. Occlusive Fungal Tracheitis in 4 Captive Bottlenose Dolphins (Tursiops truncatus). Veterinary Pathology. 2012; 50: 172-176.
  9. Petermann ER, Forrest I, Townsend Jr, Priscilla C, Barger Joseph C. Newton. A Retrospective Look at a Case of Mucormycosis in a Bottlenose Dolphin (Tursiops truncatus) Treated with Liposomal Amphotericin B and Monitored with Serum ELISA Levels. Speaker Speech Iaaam. 2012.
  10. Higgins R. Bacteria and fungi of marine mammals: A review. Can Vet J. 2000; 41: 105-116.
  11. Lipscomb TP, Kennedy S, Moffett D, et al. Morbilliviral disease in Atlantic bottlenose dolphin (Tursiops truncatus) from Gulf of Mexico. J Wildlife Dis. 1994; 30: 572-576.
  12. Reidarson TH, McBain JF, Dalton LM, et al. Mycotic diseases. In: Dierauf LA, Gulland FMD, eds. CRC Handbook of Marine Mammal Medicine. 2nd ed. Boca Raton, FL: CRC Press LLC. 2001.
  13. Barnett EF, Davison JN, Thornton SM, Riley P, Cooper T, Wessels ME. Systemic mucormycosis in a hooded seal (cystophora cristata). Journal of zoo and Wildlife Medicine. 2011; 42: 338-341.
  14. Palmero F, García-Párraga D, Martínez E, García-Hartmann M. Zygomycosis in bottlenose dolphins (Tursiops truncatus) caused by Rhizopus oryzae Presented at the Annual Symposium of the European Association for Aquatic Mammals, Tenerife. 2014.
  15. Reidarson TH. Inflammation in marine mammals. In: Zoo and wild animal medicine current therapy, ed. Fowler ME, Miller RE, 6th ed. WB Saunders, London, UK. 1999; 308-310.
  16. Manire CA, Melanie Reiber C, Gaspar C, Howard L, Byrd RL, Sweeney J, et al. Blood chemistry and hematology values in healthy and rehabilitated rough-toothed dolphins (steno bredanensis). Journal of Wildlife Diseases. 2018; 54: 1-13.
  17. Badiee P, Choopanizadeh M, Khosravi A. Sequence Base Identification of Respiratory Mucormycosis. Jundishapur J Microbiol. 2018; 11: e55026.
  18. Bragulat MR, Castelláa G, Isidoro-Ayza M, Domingo M, Cabanes F. Characterization and phylogenetic analysis of a Cunninghamella bertholletiae isolate from a bottlenose dolphin (Tursiops truncatus). Rev Iberoam Micol. 2017; 34: 215-219.
  19. Walters C, Forrest I, Townsend Jr, Lydia Staggs, Osborn DS, Pullman WA. Posaconazole for the Treatment of Zygomycosis in Cetaceans. Speaker Speech Iaaam. 2009.
  20. Tanaka Y, Toyotome T, Inokuma H, Watanabe KI, Kobayashi Y, Horiuchi N. Rhinocerebral Zygomycosis Due to a Lichtheimia ramosa Infection in a Calf: Neural Spread Through the Olfactory Nerves. Mycopathologia. 2019; 184: 141-146.
  21. Volker U, Jacobsen ID. Mucormycoses caused by Lichtheimia species mycoses. Mycoses. 2014; 57.
  22. Anane S, Kaouech E, Belhadj S, Ammari L, Abdelmalek R, Ben Chaabane T, et al. Rhino-orbito-cerebral mucormycosis in the diabetic: a better-known pathology in Tunisia. Ann Biol Clin. 2009; 67: 325-332.

Citation: Dhib I, Yaacoub A, Chouaieb H, Jaim A, Ben Said M, Letscher V, et al. Lichtheimia ramosa Mucormycosis in a Bottlenose Dolphin. Austin J Vet Sci & Anim Husb. 2019; 6(3): 1064.